B0V3M3_DANRE

Ensembl ID:
ENSDARG00000078392
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:B0V3M3]
Human Orthologue:
CHPF
Human Description:
chondroitin polymerizing factor [Source:HGNC Symbol;Acc:24291]
Mouse Orthologue:
Chpf
Mouse Description:
chondroitin polymerizing factor Gene [Source:MGI Symbol;Acc:MGI:106576]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa18938 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa18938
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113847 Essential Splice Site 99 768 1 4
Genomic Location (Zv9):
Chromosome 9 (position 11539025)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 11291590
KASP Assay ID:
2260-1552.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATAATCCCGTATAAACCAGTCAAACAGACTCAGCCCAAGAAACTTTTCAG[G/A]TAGAGTATAATAAAACCCAAGGAATGACTCCATTCCGTTGATGTAACAGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link