trip11

Ensembl ID:
ENSDARG00000078381
ZFIN ID:
ZDB-GENE-030131-9833
Description:
Novel protein similar to H.sapiens TRIP11, thyroid hormone receptor interactor 11 (TRIP11) [Source:U
Human Orthologue:
TRIP11
Human Description:
thyroid hormone receptor interactor 11 [Source:HGNC Symbol;Acc:12305]
Mouse Orthologue:
Trip11
Mouse Description:
thyroid hormone receptor interactor 11 Gene [Source:MGI Symbol;Acc:MGI:1924393]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7228 Nonsense Mutation detected in F1 DNA During 2015
sa7729 Essential Splice Site Mutation detected in F1 DNA During 2015

Mutation Details

Allele Name:
sa7228
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109667 Nonsense 846 1984 11 22
ENSDART00000134383   None 711 None 12
ENSDART00000137576   None 245 None 5
ENSDART00000146138   None 192 None 4
Genomic Location:
Chromosome 13 (position 33419534)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTRAAAACTCAAGCTGTRGAAACACAACAAGMGTTGGAGACCYGTATCT[T/A]GAGAGCAAGTCAAGAGTGTGACTCTCTCAGAAAGTCAGTGGAAGAGAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7729
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109667 Essential Splice Site 1725 1984 17 22
ENSDART00000134383 Essential Splice Site 452 711 7 12
ENSDART00000137576   None 245 None 5
ENSDART00000146138   None 192 None 4
Genomic Location:
Chromosome 13 (position 33410868)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGTGGATATAYACAGTACATTAATGCTCAATATCTACATCTGTAAACTT[A/T]GATAAACCTGGATGAAGCGAACGCAGCTCTAGAATCTGCCTCTCGCCTCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Hundreds of variants clustered in genomic loci and biological pathways affect human height. (View Study)
  • Height: Identification of ten loci associated with height highlights new biological pathways in human growth. (View Study)
  • Height: Many sequence variants affecting diversity of adult human height. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/od8lpn22