trip11

Ensembl ID:
ENSDARG00000078381
ZFIN ID:
ZDB-GENE-030131-9833
Description:
Novel protein similar to H.sapiens TRIP11, thyroid hormone receptor interactor 11 (TRIP11) [Source:U
Human Orthologue:
TRIP11
Human Description:
thyroid hormone receptor interactor 11 [Source:HGNC Symbol;Acc:12305]
Mouse Orthologue:
Trip11
Mouse Description:
thyroid hormone receptor interactor 11 Gene [Source:MGI Symbol;Acc:MGI:1924393]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35539 Essential Splice Site Mutation detected in F1 DNA During 2016
sa35538 Nonsense Mutation detected in F1 DNA During 2016
sa35537 Nonsense Available for shipment Available now
sa35536 Nonsense Mutation detected in F1 DNA During 2016
sa7228 Nonsense Mutation detected in F1 DNA During 2016
sa35535 Nonsense Mutation detected in F1 DNA During 2016
sa35534 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa35539
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109667 Essential Splice Site 235 1984 5 22
ENSDART00000134383   None 711 None 12
ENSDART00000137576   None 245 None 5
ENSDART00000146138   None 192 None 4
Genomic Location (Zv9):
Chromosome 13 (position 33423144)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 33069092
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGAAACGGAGACCAGGGTGAAGTTTTGAAAATGCAAAGAATTATCAAGG[T/G]AAAAAGCCTCTGAAATGTTACAAAGAGTAGTAGCTGTATATTTATTTAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35538
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109667 Nonsense 346 1984 7 22
ENSDART00000134383   None 711 None 12
ENSDART00000137576 Nonsense 35 245 1 5
ENSDART00000146138   None 192 None 4
Genomic Location (Zv9):
Chromosome 13 (position 33421651)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 33067599
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGAGAGCTATTGGCCACCTTAGAGGAGGCGGAGCATCATAAGACCAAGT[T/A]AGAGAGGGAGAAAGAGGAGGCAACAGCAGAAAATGCAGAACTGTTGCAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35537
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109667 Nonsense 538 1984 11 22
ENSDART00000134383   None 711 None 12
ENSDART00000137576 Nonsense 227 245 5 5
ENSDART00000146138   None 192 None 4
Genomic Location (Zv9):
Chromosome 13 (position 33420459)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 33066407
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTATTGCAGTGAAGGACCAGCTGTCCCTGCAAAAAACCCAGACTGAGGCC[G/T]AAAAAGCTCGTCTTCAGTCAGACCTCAATTCCTTACTTGACCAGAGACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35536
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109667 Nonsense 751 1984 11 22
ENSDART00000134383   None 711 None 12
ENSDART00000137576   None 245 None 5
ENSDART00000146138   None 192 None 4
Genomic Location (Zv9):
Chromosome 13 (position 33419820)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 33065768
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCTAAGTCAGACTGAGAAGCGACTGTCAGATCAGGCTAAACAATATCAA[C/T]AAACTATTGATGAACTGACCAGAGCACGTTCCATGGATGCTTCTGCACTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7228
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109667 Nonsense 846 1984 11 22
ENSDART00000134383   None 711 None 12
ENSDART00000137576   None 245 None 5
ENSDART00000146138   None 192 None 4
Genomic Location (Zv9):
Chromosome 13 (position 33419534)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 33065482
KASP Assay ID:
554-5276.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTRAAAACTCAAGCTGTRGAAACACAACAAGMGTTGGAGACCYGTATCT[T/A]GAGAGCAAGTCAAGAGTGTGACTCTCTCAGAAAGTCAGTGGAAGAGAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35535
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109667 Nonsense 988 1984 11 22
ENSDART00000134383   None 711 None 12
ENSDART00000137576   None 245 None 5
ENSDART00000146138   None 192 None 4
Genomic Location (Zv9):
Chromosome 13 (position 33419109)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 33065057
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGAGATTGCCCGGCTTCAGTCAGAAGTAGAGGGCCTAAGCACACAAGGA[C/T]GAAGTCAAATACAGTCCGTGGAAATTCTACAGGAAGATAAGACCCAGTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35534
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109667 Nonsense 1293 1984 11 22
ENSDART00000134383 Nonsense 20 711 1 12
ENSDART00000137576   None 245 None 5
ENSDART00000146138   None 192 None 4
Genomic Location (Zv9):
Chromosome 13 (position 33418193)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 33064141
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCCAGGCTTATTCAGAGCTATGAGCAGAAAGAGAAAAAGCTTGGATTGT[T/A]GAGTCAAGAGCTGGCACAGGTGCAGCAGACCATCAGCCAGCTGACCAGTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Hundreds of variants clustered in genomic loci and biological pathways affect human height. (View Study)
  • Height: Identification of ten loci associated with height highlights new biological pathways in human growth. (View Study)
  • Height: Many sequence variants affecting diversity of adult human height. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link