TRAF2 (1 of 2)

Ensembl ID:
ENSDARG00000078378
Description:
TNF receptor-associated factor 2 [Source:HGNC Symbol;Acc:12032]
Human Orthologue:
TRAF2
Human Description:
TNF receptor-associated factor 2 [Source:HGNC Symbol;Acc:12032]
Mouse Orthologue:
Traf2
Mouse Description:
TNF receptor-associated factor 2 Gene [Source:MGI Symbol;Acc:MGI:101835]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa808 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa808
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022729 Essential Splice Site 428 500 10 12
Genomic Location:
Chromosome 5 (position 5660746)
KASP Assay ID:
554-0713.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCATGAGAGGGATGAGCGACGCGCTGCTCAAATGGCCCTTCAACCAGAAG[G/A]TACATCACTGTTGATTCATTGCATGYRTTAAATACTSTTCAAAGCTTTTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/1c5qy9xn