TRAF2 (1 of 2)

Ensembl ID:
ENSDARG00000078378
Description:
TNF receptor-associated factor 2 [Source:HGNC Symbol;Acc:12032]
Human Orthologue:
TRAF2
Human Description:
TNF receptor-associated factor 2 [Source:HGNC Symbol;Acc:12032]
Mouse Orthologue:
Traf2
Mouse Description:
TNF receptor-associated factor 2 Gene [Source:MGI Symbol;Acc:MGI:101835]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31413 Essential Splice Site Available for shipment Available now
sa40355 Essential Splice Site Mutation detected in F1 DNA During 2016
sa808 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa31413
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022729 Essential Splice Site 122 500 3 12
Genomic Location (Zv9):
Chromosome 5 (position 5653370)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 5192616
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGCTTCAATGAGGGCTGCTCCTGGAAAGGCAGCATTAAAGACTATGAG[G/A]TTGTGTGTTTATTAACACAGTGATATTACCAATCATATAGTGCATAAGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40355
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022729 Essential Splice Site 319 500 8 12
Genomic Location (Zv9):
Chromosome 5 (position 5658507)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 5197753
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCGACAGCACAGACTCGACCAGGACAAAATAGAGGCACTCAGCAACAAGG[T/C]GTGTGTGCTGTACTGTACTTCAGACGAGATTTACACATGGACAATTCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa808
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022729 Essential Splice Site 428 500 10 12
Genomic Location (Zv9):
Chromosome 5 (position 5660746)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 5200005
KASP Assay ID:
554-0713.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCATGAGAGGGATGAGCGACGCGCTGCTCAAATGGCCCTTCAACCAGAAG[G/A]TACATCACTGTTGATTCATTGCATGYRTTAAATACTSTTCAAAGCTTTTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link