ENSDARG00000078362

Ensembl ID:
ENSDARG00000078362
Human Orthologue:
FN1
Human Description:
fibronectin 1 [Source:HGNC Symbol;Acc:3778]
Mouse Orthologue:
Fn1
Mouse Description:
fibronectin 1 Gene [Source:MGI Symbol;Acc:MGI:95566]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12021 Nonsense Available for shipment Available now
sa33527 Nonsense Mutation detected in F1 DNA During 2016
sa20338 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa12021
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112856 Nonsense 532 1585 2 14
Genomic Location (Zv9):
Chromosome 5 (position 5762411)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 5306393
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTGTCTGTCAGGATGGTTTTAAAGGCCAGGATTGCTCTGTTCCCACTTG[T/A]CCTGGAAACTGCAATGACCACGGGCGCTGCGTCAATGGAAAGTGTGTGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33527
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112856 Nonsense 572 1585 2 14
Genomic Location (Zv9):
Chromosome 5 (position 5762293)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 5306275
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGATGCCTGCAGTGACAGAAGCTGTCTGAATGACTGCAGTGATGTGGGA[C/T]AGTGCGTCGACGGCCGCTGCATTTGTGATGAGGGATACATTGGCGAGGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20338
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112856 Nonsense 926 1585 8 14
Genomic Location (Zv9):
Chromosome 5 (position 5743573)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 5287545
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTTCATCTGCTGGACTAACACATTTTTGTGTGCTGTAGGCTTAAAGCCT[G/T]GAACGGAGTATGGGATTGGAGTCACAGCCGTGCAGAATGAAAGAGAAAGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link