ENSDARG00000078362

Ensembl ID:
ENSDARG00000078362
Human Orthologue:
FN1
Human Description:
fibronectin 1 [Source:HGNC Symbol;Acc:3778]
Mouse Orthologue:
Fn1
Mouse Description:
fibronectin 1 Gene [Source:MGI Symbol;Acc:MGI:95566]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12021 Nonsense Available for shipment Available now
sa20338 Nonsense Mutation detected in F1 DNA During 2014
sa8365 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa12021
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112856 Nonsense 532 1585 2 14
Genomic Location:
Chromosome 5 (position 5762411)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTGTCTGTCAGGATGGTTTTAAAGGCCAGGATTGCTCTGTTCCCACTTG[T/A]CCTGGAAACTGCAATGACCACGGGCGCTGCGTCAATGGAAAGTGTGTGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20338
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112856 Nonsense 926 1585 8 14
Genomic Location:
Chromosome 5 (position 5743573)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTTCATCTGCTGGACTAACACATTTTTGTGTGCTGTAGGCTTAAAGCCT[G/T]GAACGGAGTATGGGATTGGAGTCACAGCCGTGCAGAATGAAAGAGAAAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8365
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112856 Nonsense 1160 1585 10 14
Genomic Location:
Chromosome 5 (position 5733917)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAAAATCTTCCACTGAGTWCCAAGTAAGGCTTTATGGATTATCCAATAAC[C/T]AAAGGTCTTCGCTACTAGAAGCAGTTGCAGTTACAGGTATCAGCTTTCTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/qi0h5qfs