LOC557823

Ensembl ID:
ENSDARG00000078355
Human Orthologue:
ZC3H4
Human Description:
zinc finger CCCH-type containing 4 [Source:HGNC Symbol;Acc:17808]
Mouse Orthologue:
Zc3h4
Mouse Description:
zinc finger CCCH-type containing 4 Gene [Source:MGI Symbol;Acc:MGI:2682314]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22642 Essential Splice Site Available for shipment Available now
sa42545 Nonsense Mutation detected in F1 DNA During 2016
sa35886 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa22642
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109318 Essential Splice Site 452 1340 10 14
Genomic Location:
Chromosome 15 (position 23067665)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTCTCTCATGACTCCCTAACAGAAGATACTCAAGAGTTGCTCGATAAGG[T/A]AATCTTAACATATATGTTGAAAAATATAGCTGATGCTTTGTAATTGTTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42545
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109318 Nonsense 1034 1340 14 14
Genomic Location:
Chromosome 15 (position 23065077)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCACTCCTCTATTCTCCCACCTACTGTTGTTCCTCCTCCTGCTCCTGTT[G/T]AGCAATCGAATCAGTCCTCCTCTTCCCTACCAGACTTTGAGCTACTCTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35886
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109318 Nonsense 1089 1340 14 14
Genomic Location:
Chromosome 15 (position 23064912)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATCACCTCCGTCCGTCTCATCTGAAAAGCCCATTGACCCTCGTATGGCA[C/T]GAAAAACCCCTGCTGACCCCCGATTACAGCCTCAAAAATCTGCCCTTAAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link