lrrc24

Ensembl ID:
ENSDARG00000078350
ZFIN ID:
ZDB-GENE-060503-496
Description:
Novel protein similar to vertebrate leucine rich repeat containing 14 (LRRC14) [Source:UniProtKB/TrE
Human Orthologues:
AC084125.1, LRRC24
Human Descriptions:
leucine rich repeat containing 24 [Source:HGNC Symbol;Acc:28947]
Leucine-rich repeat-containing protein 24 [Source:UniProtKB/Swiss-Prot;Acc:Q50LG9]
Mouse Orthologue:
Lrrc24
Mouse Description:
leucine rich repeat containing 24 Gene [Source:MGI Symbol;Acc:MGI:3605040]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa185 Nonsense Confirmed mutation in F2 line During 2016

Mutation Details

Allele Name:
sa185
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114047 Nonsense 38 594 1 4
ENSDART00000135916 Nonsense 17 573 1 4
Genomic Location (Zv9):
Chromosome 2 (position 52234715)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 51449146
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCTGGCTTGTCCTTCCGGGTGTCGCTGCTATAGTTTGACTGTCGAATGC[G/T]GATCCATCGGAATCAAAGAGATCCCACAAGGCATCACACAAGGGACGCAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link