LOC557711

Ensembl ID:
ENSDARG00000078349
Mouse Orthologues:
Gm4070, Gvin1
Mouse Descriptions:
GTPase, very large interferon inducible 1 Gene [Source:MGI Symbol;Acc:MGI:1921808]
predicted gene 4070 Gene [Source:MGI Symbol;Acc:MGI:3782245]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24201 Nonsense Mutation detected in F1 DNA During 2014
sa19301 Nonsense Mutation detected in F1 DNA During 2014
sa10415 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa24201
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076759 Nonsense 606 1431 3 4
Genomic Location:
Chromosome 22 (position 33350507)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAACTATGCTGAACGCCATGTTTGGACTGCAGTTTGCCGTTAGTGCTGGC[A/T]GATGCACCAGAGGAGCTTTCATGCAACTGATCAGAGTTTCAGAGGAAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19301
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076759 Nonsense 840 1431 3 4
ENSDART00000076759 Nonsense 840 1431 3 4
Genomic Location:
Chromosome 22 (position 33349805)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGTTTTCAGCTTTAGAAATTCTCTGGAAATCGCAACTTACCGAAAACTT[G/T]AGACAGAATACAGCAAATGGTCCTGGAACCTTCGCAAAACTATGTTGGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10415
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076759 Nonsense 840 1431 3 4
ENSDART00000076759 Nonsense 840 1431 3 4
Genomic Location:
Chromosome 22 (position 33349805)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGTTTTCAGCTTYAGAAATTCTCTGGAAATCGCAACWTAYCGAAAACTT[G/T]AGACMGAATACAGCAAATGGTCCTGGAACCTTCGCAAAACTATGTTGRAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/17l6pudh