LOC100006417

Ensembl ID:
ENSDARG00000078348
Human Orthologue:
TCF20
Human Description:
transcription factor 20 (AR1) [Source:HGNC Symbol;Acc:11631]
Mouse Orthologues:
AU017455, Tcf20
Mouse Descriptions:
expressed sequence AU017455 Gene [Source:MGI Symbol;Acc:MGI:2145729]
transcription factor 20 Gene [Source:MGI Symbol;Acc:MGI:108399]

Alleles

There are 12 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19926 Nonsense Available for shipment Available now
sa33072 Nonsense Mutation detected in F1 DNA During 2016
sa11692 Nonsense Available for shipment Available now
sa33071 Nonsense Available for shipment Available now
sa17263 Nonsense Available for shipment Available now
sa11228 Nonsense Available for shipment Available now
sa33070 Nonsense Mutation detected in F1 DNA During 2016
sa19925 Nonsense Available for shipment Available now
sa10342 Nonsense Available for shipment Available now
sa12722 Nonsense Available for shipment Available now
sa39970 Nonsense Mutation detected in F1 DNA During 2016
sa1165 Essential Splice Site Confirmed mutation in F2 line During 2016

Mutation Details

Allele Name:
sa19926
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111739 Nonsense 26 2354 1 4
Genomic Location (Zv9):
Chromosome 3 (position 2032156)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 1499333
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTCTCCACCCAGGGTTCAGCCGTGGAGCAGGCGTAGTCAGTTCCCCATA[T/A]CAGACCCACCCGTCAGACCTTCAGATCTCCCCCAGGACCTCCGAGGACTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33072
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111739 Nonsense 27 2354 1 4
Genomic Location (Zv9):
Chromosome 3 (position 2032155)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 1499332
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCTCCACCCAGGGTTCAGCCGTGGAGCAGGCGTAGTCAGTTCCCCATAT[C/T]AGACCCACCCGTCAGACCTTCAGATCTCCCCCAGGACCTCCGAGGACTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11692
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111739 Nonsense 174 2354 1 4
Genomic Location (Zv9):
Chromosome 3 (position 2031714)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 1498891
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGTCGTGGGGAGTAATMGCAGTGCAGCTGGTTCGTTTTCTCCTTCCCAG[C/T]AATACAGTATGGCTCACGCTGCTTCAGTACAATCAAGTGCTCAAATGCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33071
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111739 Nonsense 175 2354 1 4
Genomic Location (Zv9):
Chromosome 3 (position 2031709)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 1498886
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGGGGAGTAATAGCAGTGCAGCTGGTTCGTTTTCTCCTTCCCAGCAATA[C/A]AGTATGGCTCACGCTGCTTCAGTACAATCAAGTGCTCAAATGCATCAACG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17263
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111739 Nonsense 297 2354 1 4
Genomic Location (Zv9):
Chromosome 3 (position 2031344)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 1498521
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATGGGGCAGGGCKACTCCTCGTCWGCACAYCCACCGTATTCACCACAGT[C/A]GCTTCACAAGCACGGCCCCCATTCCCAGCGTACCCCTCAACACAGYGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11228
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111739 Nonsense 857 2354 1 4
Genomic Location (Zv9):
Chromosome 3 (position 2029665)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 1496842
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTCYGTTCAATCTCACCCAGTGTCATTTAAATGCAGCAATCCAGAGGTA[C/T]AATACACTGCCGTAAAGAGCAAGGACAAATTAGGGCTAGGTAGTGTTATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33070
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111739 Nonsense 1019 2354 1 4
Genomic Location (Zv9):
Chromosome 3 (position 2029177)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 1496354
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTCAGGGACCAGATAGTGAGATTGGTTTAGGCCCTTCTCATCCCTCTTG[G/A]GATTCTGAAGCACATAAGACTCACGGGATCTCCATAGAGAAAAGCAAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19925
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111739 Nonsense 1332 2354 1 4
Genomic Location (Zv9):
Chromosome 3 (position 2028239)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 1495416
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGGCACGGTCCTCAGAGAATCCCCGAACAGAAATGTAAAAGCCAGCCTT[C/A]AAGTGAAATTCTGTCTAGTCCACATCGTATATCTCAACAGCACTCTTATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10342
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111739 Nonsense 1536 2354 1 4
Genomic Location (Zv9):
Chromosome 3 (position 2027627)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 1494804
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCCTCCTCAGTCCAAAGCAAAGTTTCTTCCCCCAAGAAAGGGGCGTGGCT[T/A]GAAACTTGAGGCGATTGTGCAGAAAATTACTCCTGGCGTGAGAAAAAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12722
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111739 Nonsense 1602 2354 1 4
Genomic Location (Zv9):
Chromosome 3 (position 2027429)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 1494606
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCTCAAGGTGAGGAGACCTGWTTATCTTACCTTGAGGATTCTCATACTT[T/A]AGATGASCTTATGCCATACAGAGCAGTTGAARATGCATTCTCATGTGACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39970
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111739 Nonsense 1803 2354 1 4
Genomic Location (Zv9):
Chromosome 3 (position 2026827)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 1494004
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCGCCCAGTCGGTAGTGTGAATAAGCAGAAACGTGCCCAAGGACAAATG[C/T]AGAATACAGCAACTAACATACCTGCAGCTCCTCTTCCCTCACCTACAGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1165
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111739 Essential Splice Site 2289 2354 2 4
Genomic Location (Zv9):
Chromosome 3 (position 2025264)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 1492441
KASP Assay ID:
554-1075.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATGGATTAATTGAGACTTTCCTSTTTTCTTGTGGTTTCATTCTCTCCTC[A/T]GAGCTGCTCTCATTGTGAGATGGCGGGCTCCACCCTCGGCTGCTACAGTA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link