TM7SF4

Ensembl ID:
ENSDARG00000078347
Description:
transmembrane 7 superfamily member 4 [Source:HGNC Symbol;Acc:18549]
Human Orthologue:
TM7SF4
Human Description:
transmembrane 7 superfamily member 4 [Source:HGNC Symbol;Acc:18549]
Mouse Orthologue:
Tm7sf4
Mouse Description:
transmembrane 7 superfamily member 4 Gene [Source:MGI Symbol;Acc:MGI:1923016]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa36241 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa36241
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114152 Nonsense 38 390 1 6
Genomic Location (Zv9):
Chromosome 16 (position 47169484)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 44368274
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAGTCTACTGCTCACCTTAGGAACCAGTTTGGTGGTTTTCTTCAACATC[C/T]AGAACACATTACAAAACATGAAACTGCTTGCAAAAGGCCTCCTCTGCAAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Paget's disease: Genome-wide association identifies three new susceptibility loci for Paget's disease of bone. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link