si:dkey-13f9.6

Ensembl ID:
ENSDARG00000078335
ZFIN IDs:
ZDB-GENE-030131-7487, ZDB-GENE-091204-390
Human Orthologue:
AMOT
Human Description:
angiomotin [Source:HGNC Symbol;Acc:17810]
Mouse Orthologue:
Amot
Mouse Description:
angiomotin Gene [Source:MGI Symbol;Acc:MGI:108440]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1663 Nonsense Available for shipment Available now
sa3123 Nonsense F2 line generated During 2017
sa12125 Essential Splice Site Available for shipment Available now
sa12810 Nonsense Available for shipment Available now
sa16908 Nonsense Available for shipment Available now
sa3119 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa1663
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114778 Nonsense 12 968 1 10
ENSDART00000141096 Nonsense 12 606 3 7
Genomic Location (Zv9):
Chromosome 21 (position 36839933)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 37829282
KASP Assay ID:
554-1610.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCACGAGATCTGGAAATGAGGGCAGCAGCCTCAGTTTCCGAGGACACAT[C/A]GGCTAAYAACAGYGGTGGGAGTGGACACACGGTTCTGCAGCGGCTCTTGC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa3123
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114778 Nonsense 64 968 1 10
ENSDART00000141096 Nonsense 64 606 3 7
Genomic Location (Zv9):
Chromosome 21 (position 36840088)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 37829437
KASP Assay ID:
554-2955.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCAGCAAGGTCCAGTAAGCGGATACCCAGGGCCTGGCAGCCCAGCAGAC[G/T]AGCACTCGATGGTCCCACACATTGCGCGACAAGAGCCTCAGGGCCAGGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12125
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114778 Essential Splice Site 479 968 3 10
ENSDART00000141096 Essential Splice Site 479 606 5 7
Genomic Location (Zv9):
Chromosome 21 (position 36842473)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 37831822
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAATCTGTTTTGTTGTTTCTGTGAGGCCTCAGCAATGTAAWCTCTTTACA[G/T]ATGGAGACTGAGATCCAGATGGTGTCAGAAGCTTACGAGAACTTGGCTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12810
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114778 Nonsense 553 968 4 10
ENSDART00000141096 Nonsense 553 606 6 7
Genomic Location (Zv9):
Chromosome 21 (position 36852026)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 37841375
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCGCTGCAAAAGAGTGTGAGGGCACAGAGGAYAATCGWAAAACCATCTCA[C/T]AGCTTCWGGWTCAGGGTGAGTGGACCTACAGGTACAAGAAACCCGGAAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16908
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114778 Nonsense 719 968 7 10
ENSDART00000141096   None 606 None 7
Genomic Location (Zv9):
Chromosome 21 (position 36861016)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 37850200
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAGCGTCATGAGGCAGTTCGCACTGGATGCCGCTGCTTCTGTGGCCACA[C/T]AGAGGTGRACACATWCACTGCTCTACACTGAACATGCRCTGTACAATTAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3119
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114778 Nonsense 853 968 9 10
ENSDART00000141096   None 606 None 7
Genomic Location (Zv9):
Chromosome 21 (position 36864702)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 37853886
KASP Assay ID:
554-2814.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTCAATCTGATTTGCTCCTCTTCATGTTTCAGGTGTTCTGCTGGGTCCA[G/T]AGTTCCGTGGAGACTCTCTGAGAACAGAGTCCATTTCCTCTTCTCCATCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link