si:ch73-344o19.2

Ensembl ID:
ENSDARG00000078329
ZFIN ID:
ZDB-GENE-081104-283
Description:
Novel protein similar to vertebrate REC8 homolog (Yeast) (REC8) [Source:UniProtKB/TrEMBL;Acc:B8JLA8]
Human Orthologue:
REC8
Human Description:
REC8 homolog (yeast) [Source:HGNC Symbol;Acc:16879]
Mouse Orthologue:
Rec8
Mouse Description:
REC8 homolog (yeast) Gene [Source:MGI Symbol;Acc:MGI:1929645]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa15212 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa15212
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100232 Essential Splice Site 209 411 8 12
ENSDART00000126001 Essential Splice Site 195 408 7 14
ENSDART00000139842 Essential Splice Site 198 460 7 13
Genomic Location (Zv9):
Chromosome 2 (position 5866410)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 6312138
KASP Assay ID:
2259-1557.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTCCATYACTCTGACAGAACCAGAGCCACTCATCATGCCTGAGCCACAG[G/A]TACATCCAACCCAGGCTCATTATTGAGACATACCCYTGTATAGTTTTCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link