sec22a

Ensembl ID:
ENSDARG00000078328
ZFIN ID:
ZDB-GENE-030131-3553
Description:
vesicle-trafficking protein SEC22a [Source:RefSeq peptide;Acc:NP_955992]
Human Orthologue:
SEC22A
Human Description:
SEC22 vesicle trafficking protein homolog A (S. cerevisiae) [Source:HGNC Symbol;Acc:20260]
Mouse Orthologue:
Sec22a
Mouse Description:
SEC22 vesicle trafficking protein homologe A (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:2447876

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21543 Nonsense Available for shipment Available now
sa21544 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21543
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082165 Nonsense 29 303 2 7
ENSDART00000109110 Nonsense 29 303 1 6
ENSDART00000133643 Nonsense 29 205 2 5
Genomic Location (Zv9):
Chromosome 9 (position 38903442)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 38041338
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAGGGACGGTTTGCCTCTCTCAGCCTCCACAGACTATGAACTGGATAAA[G/T]GAATTCAGGAGACAAAGAAACATCTCAAGGTCCTGTCCAAAAAACTCAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21544
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082165 Nonsense 87 303 3 7
ENSDART00000109110 Nonsense 87 303 2 6
ENSDART00000133643 Nonsense 87 205 3 5
Genomic Location (Zv9):
Chromosome 9 (position 38906254)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 38044150
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTGATGGTTTGCACAGAGAACTATCCCAATGTCCTGGCCTTCAGCTTCT[T/G]AGATGAGCTTCAGAGAGAGTTCATAGTCACGTATGACACCAAGCGGATCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link