si:ch73-212j7.1

Ensembl ID:
ENSDARG00000078327
ZFIN ID:
ZDB-GENE-081104-258
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:B8JKV3]
Human Orthologue:
KIAA0284
Human Description:
KIAA0284 [Source:HGNC Symbol;Acc:20362]
Mouse Orthologue:
AW555464
Mouse Description:
expressed sequence AW555464 Gene [Source:MGI Symbol;Acc:MGI:2145043]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10696 Nonsense Available for shipment Available now
sa17237 Nonsense Available for shipment Available now
sa23625 Nonsense Available for shipment Available now
sa9972 Nonsense Available for shipment Available now
sa36946 Nonsense Mutation detected in F1 DNA During 2017
sa18015 Essential Splice Site Available for shipment Available now
sa8550 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa10696
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112848 Nonsense 732 1687 9 18
ENSDART00000132972   None 202 None 6
ENSDART00000133435 Nonsense 159 234 2 3
Genomic Location (Zv9):
Chromosome 20 (position 3153502)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 3107364
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTWACATTTCACAGGTGTTTGGTGTTTTAGATGCGCCAGAATACAGTGGT[C/T]AGACTCTTGGAGTTTATAGGCCTGTGATTGATGATGGGGACAATGAGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17237
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112848 Nonsense 787 1687 10 18
ENSDART00000132972   None 202 None 6
ENSDART00000133435 Nonsense 214 234 3 3
Genomic Location (Zv9):
Chromosome 20 (position 3153782)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 3107644
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TKTAAAACATAMCTTTTGTAATTTAGGCACATCCTGGTGTAGTAGGGCCT[A/T]AATGGGTCTCGCGTTGGGCCAGCCTTGCAGACCCTTATAGTGATCCCGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23625
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112848 Nonsense 917 1687 11 18
ENSDART00000132972   None 202 None 6
ENSDART00000133435   None 234 None 3
Genomic Location (Zv9):
Chromosome 20 (position 3154289)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 3108151
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGACAGTCTGAGTGACACCAGCCGTTCAGATGACAGCTCTATCCTTGAT[A/T]GAAGCGGTAGGAGCCAAGGAAAACGAGGAACTACAAGACACCTACCTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9972
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112848 Nonsense 963 1687 11 18
ENSDART00000132972   None 202 None 6
ENSDART00000133435   None 234 None 3
Genomic Location (Zv9):
Chromosome 20 (position 3154428)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 3108290
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAACCTACACCCAAACCCACTTCATTTTATATCGGTTCTGAGGATGGTT[T/G]ATCCAAGTCCGATGTGTCCAAAAGYCCAGTTCTTTCACAGCCAGAGAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36946
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112848 Nonsense 1101 1687 11 18
ENSDART00000132972   None 202 None 6
ENSDART00000133435   None 234 None 3
Genomic Location (Zv9):
Chromosome 20 (position 3154841)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 3108703
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAAGTTGTCTGGATGTAGTCAACGATCAAAAAAAGGAAGCTCTCCTGCA[C/T]AAGAAGACTCCTTTTCTGGTGACTCAGATGTGGATACTGCCAGTACTGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18015
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112848 Essential Splice Site 1378 1687 11 18
ENSDART00000132972   None 202 None 6
ENSDART00000133435   None 234 None 3
Genomic Location (Zv9):
Chromosome 20 (position 3155676)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 3109538
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACACTCCTCCCRTACCCATTCTACCCAAGTTAAWCACAGTAGCACAGCTG[G/A]TAGGTATTAGTCARTTTATTTCTCTTATGCTGTGTTCACACCAGACGCGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8550
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112848 Nonsense 1521 1687 14 18
ENSDART00000132972 Nonsense 66 202 2 6
ENSDART00000133435   None 234 None 3
Genomic Location (Zv9):
Chromosome 20 (position 3160106)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 3113968
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGATTAAKCTGCAGCTGGTACAGCATATACCCGAGGCAAGTTTGAACTA[T/A]CAAAAGGTTCCTCCAGGCTCAACTAGTCCAAWAGACCAGGACTCAAATAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link