arhgap10

Ensembl ID:
ENSDARG00000078326
ZFIN ID:
ZDB-GENE-060512-221
Description:
rho GTPase-activating protein 10 [Source:RefSeq peptide;Acc:NP_001038715]
Human Orthologue:
ARHGAP10
Human Description:
Rho GTPase activating protein 10 [Source:HGNC Symbol;Acc:26099]
Mouse Orthologue:
Arhgap10
Mouse Description:
Rho GTPase activating protein 10 Gene [Source:MGI Symbol;Acc:MGI:1925764]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39645 Nonsense Mutation detected in F1 DNA During 2016
sa32716 Essential Splice Site Mutation detected in F1 DNA During 2016
sa24852 Nonsense Mutation detected in F1 DNA During 2016
sa6595 Essential Splice Site Mutation detected in F1 DNA During 2016
sa25621 Essential Splice Site Mutation detected in F1 DNA During 2016
sa14465 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa39645
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109314 Nonsense 12 764 1 23
Genomic Location (Zv9):
Chromosome 1 (position 36480498)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 36040356
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGAGTCCAGTAAAAATGGGTTTACACCCGTTGGAGTTCAGTGAATGTTA[C/A]CTGGACAGTCCTGCTTTCAGGGACAAAATCAAAGCTCATGAAGCAGAGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32716
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109314 Essential Splice Site 128 764 4 23
Genomic Location (Zv9):
Chromosome 1 (position 36538286)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 36098144
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGATGAAGCCCTTAGAAAACTTTCGAAAAGAGCATCTTGGCTCAGCAAAG[G/A]TAAATTCGGTTTCAGATCATCTCTCATTATTTATTAAATATAGGATGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24852
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109314 Nonsense 375 764 12 23
Genomic Location (Zv9):
Chromosome 1 (position 36553120)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 36112683
KASP Assay ID:
554-7825.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGGTCTGGTTTGTGTTTTCTGATGTTTATCTCTCTCATGCAGATGCAGTG[T/A]CTCAACCGGACACATTCAAGAGAAAGAGGAAGTAAGAGACCAAATTAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6595
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109314 Essential Splice Site 481 764 16 23
Genomic Location (Zv9):
Chromosome 1 (position 36565522)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 36125085
KASP Assay ID:
554-4100.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAGCCTCTAATGACATACGAGCTGTATAAGGAGTTCATCGTCCCTGCAA[G/A]TAAGGTCTTTGTCCTTGCTTTGACAATAATCAAGYAATACCCAAAACGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25621
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109314 Essential Splice Site 570 764 18 23
Genomic Location (Zv9):
Chromosome 1 (position 36575648)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 36135211
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAGTTCCAGAACATTGTGGTGGAAATTCTCATAGAACAGCATGAAAAGG[T/C]GAGTGACAAGTTACACATAATGAGTGAGCTTTATTTATTGATTTTCAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14465
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109314 Nonsense 627 764 20 23
Genomic Location (Zv9):
Chromosome 1 (position 36596242)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 36155805
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTKCTGCTTGCTGTGACAGTGTCTCCATCCYCTGAGAGTGYAGGCCTGTG[T/A]AATGATGAGACATCAGTGGGCAGTAATGAGTCAGTCTCCTCCCAGTCMTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link