prdm16

Ensembl ID:
ENSDARG00000078324
ZFIN ID:
ZDB-GENE-080613-2
Description:
Novel protein similar to H.sapiens PRDM16, PR domain containing 16 (PRDM16) [Source:UniProtKB/TrEMBL
Human Orthologue:
PRDM16
Human Description:
PR domain containing 16 [Source:HGNC Symbol;Acc:14000]
Mouse Orthologue:
Prdm16
Mouse Description:
PR domain containing 16 Gene [Source:MGI Symbol;Acc:MGI:1917923]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31682 Nonsense Available for shipment Available now
sa14462 Nonsense Available for shipment Available now
sa14438 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa31682
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086053 Nonsense 403 1200 9 16
ENSDART00000122737 Nonsense 134 927 4 10
Genomic Location (Zv9):
Chromosome 8 (position 50650246)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 48502656
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATTAATCAGTCATGTGTGTTCTCCCAGGTGAGGTGTGTCACAAATCGTA[T/G]ACCCAGTTCTCTAACCTGTGCCGTCACAAACGGATGCATGCAGACTGCCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14462
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086053 Nonsense 884 1200 9 16
ENSDART00000122737 Nonsense 615 927 4 10
Genomic Location (Zv9):
Chromosome 8 (position 50651689)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 48504099
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACATCRCTCCCCCAGCCACCTGTTCCCCAGCAGCWGCCATCGCTTCACTA[T/A]GCCAAGCCCTCGCCATTCTTCATGGACCCTATTTACAGGTATTTCAACCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14438
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086053 Essential Splice Site 1197 1200 None 16
ENSDART00000122737   928 927 None 10
Genomic Location (Zv9):
Chromosome 8 (position 50672465)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 48524875
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGATGAGGAGCCCACCCCTCTGCCTATGTCTTATGAACACACGCGCAGG[T/A]SAGCAGAMCATTCAGTAAAACACTCAGACTTWAATCAACACTCTTGCTAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link