col12a1

Ensembl ID:
ENSDARG00000078322
ZFIN ID:
ZDB-GENE-090728-1
Description:
Collagen XII alpha-1 chain [Source:UniProtKB/TrEMBL;Acc:B5DC62]
Human Orthologue:
COL12A1
Human Description:
collagen, type XII, alpha 1 [Source:HGNC Symbol;Acc:2188]
Mouse Orthologue:
Col12a1
Mouse Description:
collagen, type XII, alpha 1 Gene [Source:MGI Symbol;Acc:MGI:88448]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12155 Essential Splice Site Available for shipment Available now
sa850 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12155
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113323 Essential Splice Site 133 355 3 8
Genomic Location:
Chromosome 17 (position 50368877)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTACCGCATTGGCTACGCAYCCACCACWGGAGATCCCATTGARGAATTTG[T/C]AAGTCGTTTTGYATTTTATAYGAGTGTTTATTGCAGGACGATCACRTAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa850
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113323 Nonsense 267 355 7 8
Genomic Location:
Chromosome 17 (position 50364059)
KASP Assay ID:
554-0753.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGTTGTGGAGATRTTTTAATTGTACGTCKCTGTTGACCATTGCAGTGTA[T/A]CTCAACGTGACCGACCTCACTTCCTACAACGTGGGCTACGACTCTTTCTG
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/iemr0ebh