si:ch211-288h2.6

Ensembl ID:
ENSDARG00000078318
ZFIN ID:
ZDB-GENE-090312-131
Human Orthologue:
TMOD1
Human Description:
tropomodulin 1 [Source:HGNC Symbol;Acc:11871]
Mouse Orthologue:
Tmod1
Mouse Description:
tropomodulin 1 Gene [Source:MGI Symbol;Acc:MGI:98775]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19446 Nonsense Available for shipment Available now
sa39566 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa19446
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111485 Nonsense 4 356 1 9
Genomic Location (Zv9):
Chromosome 1 (position 11527858)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 11544687
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTTTTTCTATCCCCTCCTTCCCCCTTTTTGTCATTCATCATGCTTCGT[A/T]AAGAGATGGAGAAGTACCGGGATGTGGATGAGGATGAGCTTTTGCAGAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39566
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111485 Essential Splice Site 338 356 8 9
Genomic Location (Zv9):
Chromosome 1 (position 11548124)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 11564953
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCCCACGCTTGCGTGGATCCAATGCTATGATGAACAACAACGACATGGG[T/A]AAGAAGTACACTCACACTGAGAAATAATTTTTAGAGCTAATTTTGGAGAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link