si:dkey-175m17.7

Ensembl ID:
ENSDARG00000078317
ZFIN ID:
ZDB-GENE-091204-18
Human Orthologue:
DUSP10
Human Description:
dual specificity phosphatase 10 [Source:HGNC Symbol;Acc:3065]
Mouse Orthologue:
Dusp10
Mouse Description:
dual specificity phosphatase 10 Gene [Source:MGI Symbol;Acc:MGI:1927070]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43659 Nonsense Mutation detected in F1 DNA During 2017
sa23954 Nonsense Available for shipment Available now
sa7482 Missense Mutation detected in F1 DNA During 2017
sa1705 Nonsense F2 line generated During 2017

Mutation Details

Allele Name:
sa43659
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109626 Nonsense 215 904 1 3
ENSDART00000139058 Nonsense 215 892 1 3
Genomic Location (Zv9):
Chromosome 21 (position 26678090)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 27247001
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTACAGTATCTCCTGGAGGAATATTGGAGTTTGTACCAGCTCAAAGACAG[C/T]AGTCAAAATCCAAACCAACAAGAGAGAGAGACTTGTCATCAAAGACTTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23954
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109626 Nonsense 319 904 1 3
ENSDART00000139058 Nonsense 319 892 1 3
Genomic Location (Zv9):
Chromosome 21 (position 26678402)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 27247313
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCAGCACATCAGTCAGCCCCGTTCGTCACGAATTAGAGAACATCGGCCA[C/T]AAATTCTTCACGCCTTGCCTCTCTCACCTACATCTTCCCGGGGAGGCTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7482
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109626 Missense 417 904 1 3
ENSDART00000139058 Missense 417 892 1 3
Genomic Location (Zv9):
Chromosome 21 (position 26678698)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 27247609
KASP Assay ID:
554-4093.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAGGGTGTCTATCTACTGCTTCCACCACCAACACCTCCTCTTCCAATAG[C/A]ACTGTCTCAGATTGTCGTACAGGACTGCTTAGACCATTAGGTTGTGCATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1705
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109626 Nonsense 808 904 2 3
ENSDART00000139058 Nonsense 796 892 2 3
Genomic Location (Zv9):
Chromosome 21 (position 26680469)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 27249380
KASP Assay ID:
554-1651.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACAAAAGRCTCCCCGCTACTGACAACAGCAAGCAGAACCTGCGACAGTA[T/A]TTCGAAGAGGTTTTTGAGTTTATAGGTAAGAGAACGTGTCAACTTTTGTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Colorectal cancer: Meta-analysis of three genome-wide association studies identifies susceptibility loci for colorectal cancer at 1q41, 3q26.2, 12q13.13 and 20q13.33. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link