dcaf6

Ensembl ID:
ENSDARG00000078311
ZFIN ID:
ZDB-GENE-090206-2
Description:
DDB1- and CUL4-associated factor 6 [Source:RefSeq peptide;Acc:NP_001138562]
Human Orthologue:
DCAF6
Human Description:
DDB1 and CUL4 associated factor 6 [Source:HGNC Symbol;Acc:30002]
Mouse Orthologue:
Dcaf6
Mouse Description:
DDB1 and CUL4 associated factor 6 Gene [Source:MGI Symbol;Acc:MGI:1921356]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41468 Nonsense Mutation detected in F1 DNA During 2017
sa2525 Nonsense F2 line generated During 2017
sa21532 Nonsense Available for shipment Available now
sa25430 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa41468
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111027 Nonsense 131 988 4 21
ENSDART00000113194 Nonsense 131 907 4 19
ENSDART00000142664   None 271 None 5
Genomic Location (Zv9):
Chromosome 9 (position 35175688)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 34395199
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGGCATCATTTTCTACACACACACAGAGAAGAGCCAAGAAATCAACAGA[C/T]AGTGCCAGTTCACCTGCCACTATGGCACTGCTTATGAGGTACGAGCGTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2525
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111027 Nonsense 348 988 9 21
ENSDART00000113194 Nonsense 348 907 9 19
ENSDART00000142664 Nonsense 51 271 2 5
ENSDART00000111027 Nonsense 348 988 9 21
ENSDART00000113194 Nonsense 348 907 9 19
ENSDART00000142664 Nonsense 51 271 2 5
Genomic Location (Zv9):
Chromosome 9 (position 35161134)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 34380645
KASP Assay ID:
554-3430.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTCCGAATGTTTCACTCATGCAGAGGATGTCGGACATGTTATCTCGATG[G/A]TTTGAGGAGGCCAGCGAGGCTCAGAGCAGCAGAGCTCGTCCACAAACTCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21532
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111027 Nonsense 478 988 10 21
ENSDART00000113194 Nonsense 478 907 10 19
ENSDART00000142664 Nonsense 185 271 3 5
Genomic Location (Zv9):
Chromosome 9 (position 35160608)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 34380119
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAGAGCCAGGGTGAAGTCACGCCCACTCCCTCAGCCACGCCCACTCCCT[C/A]AGCCACACCCACTGCATCTAGAGAGGCAGCTTTGTCTGGTAAGATAACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25430
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111027 Nonsense 601 988 13 21
ENSDART00000113194 Nonsense 528 907 11 19
ENSDART00000142664   None 271 None 5
Genomic Location (Zv9):
Chromosome 9 (position 35151057)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 34370568
KASP Assay ID:
554-7568.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAAGCTTCTCCAGAGACTACGGAAAGTGTGCCATCCACATCAGCGCCTT[C/A]GCTTGGCACCAGCCCTGGCAACATCAGCGTCAGCACTCCTTCGGGATCTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link