A8WFV4_DANRE

Ensembl ID:
ENSDARG00000078310
Description:
LOC799918 protein [Source:UniProtKB/TrEMBL;Acc:A8WFV4]
Human Orthologues:
AC090616.1, CECR2
Human Description:
cat eye syndrome chromosome region, candidate 2 [Source:HGNC Symbol;Acc:1840]
Mouse Orthologue:
Cecr2
Mouse Description:
cat eye syndrome chromosome region, candidate 2 homolog (human) Gene [Source:MGI Symbol;Acc:MGI:1923

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38037 Essential Splice Site Mutation detected in F1 DNA During 2016
sa17892 Essential Splice Site Available for shipment Available now
sa39477 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa38037
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110426 Essential Splice Site 306 1502 9 18
Genomic Location (Zv9):
Chromosome 25 (position 17037016)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 16583560
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTTGTTTAATGTGATGTAAGCTATAGTTTAATTTCTGCATGTATATGAA[G/A]CAGATGCAAGCCACAACTGAGGAGGAGAGGCAAAGGGATGAGGACCTGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17892
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110426 Essential Splice Site 441 1502 12 18
Genomic Location (Zv9):
Chromosome 25 (position 17038301)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 16584845
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGAACCTGTTGATGAGTCTTACGCACCTAACTATCATGAAATYATACAG[G/A]TGGGCATAAAAGATNNNNNNNNATTAWTCAATTATTATTAAAGAATAATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39477
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110426 Essential Splice Site 484 1502 14 18
Genomic Location (Zv9):
Chromosome 25 (position 17038905)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 16585449
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAACAGGCTGTGTATGTGTGTGTTGTATTTACCTGTTTTTGTCTCCTCA[G/T]AATACACAATAATGGCTGAGTCCTTGGAACGCTGCTTTACCCGAGCCTTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link