A8WFV4_DANRE

Ensembl ID:
ENSDARG00000078310
Description:
LOC799918 protein [Source:UniProtKB/TrEMBL;Acc:A8WFV4]
Human Orthologues:
AC090616.1, CECR2
Human Description:
cat eye syndrome chromosome region, candidate 2 [Source:HGNC Symbol;Acc:1840]
Mouse Orthologue:
Cecr2
Mouse Description:
cat eye syndrome chromosome region, candidate 2 homolog (human) Gene [Source:MGI Symbol;Acc:MGI:1923

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa17892 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa17892
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110426 Essential Splice Site 441 1502 12 18
Genomic Location:
Chromosome 25 (position 17038301)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGAACCTGTTGATGAGTCTTACGCACCTAACTATCATGAAATYATACAG[G/A]TGGGCATAAAAGATNNNNNNNNATTAWTCAATTATTATTAAAGAATAATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/xh8gerst