si:ch211-13f8.2

Ensembl ID:
ENSDARG00000078299
ZFIN ID:
ZDB-GENE-070705-32
Description:
Novel protein similar to vertebrate glycosyltransferase 25 domain containing 1 (GLT25D1) [Source:Uni
Human Orthologue:
GLT25D2
Human Description:
glycosyltransferase 25 domain containing 2 [Source:HGNC Symbol;Acc:16790]
Mouse Orthologue:
Glt25d2
Mouse Description:
glycosyltransferase 25 domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:2138232]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39768 Splice Site, Nonsense Mutation detected in F1 DNA During 2017
sa18548 Essential Splice Site Available for shipment Available now
sa6826 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa39768
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110689 Splice Site, Nonsense 121 521 3 11
ENSDART00000146547 Splice Site, Nonsense 198 598 4 12
Genomic Location (Zv9):
Chromosome 2 (position 6924061)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 7347631
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCTCGACTCAAGAACGCTCTATTCAAACTTCTGGTGTGGCATGACCTCA[C/T]AGGTACAATACGCCTTTTCATCTTTCATTACAAAGACTTCCATTCATATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18548
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110689 Essential Splice Site 122 521 4 11
ENSDART00000146547 Essential Splice Site 199 598 5 12
Genomic Location (Zv9):
Chromosome 2 (position 6926559)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 7350129
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCTGCACCACGTGTTGRTAATCTCGAAAATATCTGATTYTTCTTTCWGC[A/T]GGGCTATTATAAGYGAACACCACATTATGTACCCATTCGAACCTGGAAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6826
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110689 Essential Splice Site 290 521 8 11
ENSDART00000146547 Essential Splice Site 367 598 9 12
Genomic Location (Zv9):
Chromosome 2 (position 6932623)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 7356193
KASP Assay ID:
554-5008.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGTKACACAACATGCCGCTGTCAAAAATGACTTCTTTCTGTTTCTYCTC[A/C]GAGCCATGAATTCAACTCAGCTYAGGACTTTAGGAATTGAGATGCTTCCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link