si:dkey-197c15.4

Ensembl ID:
ENSDARG00000078297
ZFIN ID:
ZDB-GENE-091204-315
Human Orthologue:
PTPRH
Human Description:
protein tyrosine phosphatase, receptor type, H [Source:HGNC Symbol;Acc:9672]
Mouse Orthologue:
Ptprh
Mouse Description:
protein tyrosine phosphatase, receptor type, H Gene [Source:MGI Symbol;Acc:MGI:3026877]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa14437 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa14437
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111090 Essential Splice Site 233 327 8 11
ENSDART00000131392 Essential Splice Site 687 770 14 15
Genomic Location (Zv9):
Chromosome 24 (position 7829157)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 7686449
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAGAGGTGAAGTSAAATRTTTATTCCTTTGGTTATATTCTCTAYAATRTA[G/A]TGCTGGAGTGGGCCAGACAGGAACACTGAKCGCACTGGACGTCCTGCTGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link