LOC569706

Ensembl ID:
ENSDARG00000078284
Human Orthologue:
PHKB
Human Description:
phosphorylase kinase, beta [Source:HGNC Symbol;Acc:8927]
Mouse Orthologue:
Phkb
Mouse Description:
phosphorylase kinase beta Gene [Source:MGI Symbol;Acc:MGI:97578]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18377 Nonsense Available for shipment Available now
sa21041 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa18377
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112543 Nonsense 223 1093 7 33
Genomic Location:
Chromosome 7 (position 43270407)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTTCTGTGTGGAGAGGGCGTACCGTGTGCCAGACTTTGGCATGTGGGAA[C/T]GRGGAAGCAAATATAACAATGGAAGCACAGAACTCCATTCAAGGYGAGYT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21041
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112543 Essential Splice Site 627 1093 20 33
Genomic Location:
Chromosome 7 (position 43196755)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTTGGTTTTGTTTACAGTGATTTAAGAGAACAATGATATTTTGGTTTCT[A/G]GGGGGAGCCGATTTAACCCCATCCTGGACATGCTGGCATCTTTCAAGAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/2oi0ppym