LOC569706

Ensembl ID:
ENSDARG00000078284
Human Orthologue:
PHKB
Human Description:
phosphorylase kinase, beta [Source:HGNC Symbol;Acc:8927]
Mouse Orthologue:
Phkb
Mouse Description:
phosphorylase kinase beta Gene [Source:MGI Symbol;Acc:MGI:97578]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18377 Nonsense Available for shipment Available now
sa21041 Essential Splice Site Mutation detected in F1 DNA During 2015
sa27013 Essential Splice Site Mutation detected in F1 DNA During 2015

Mutation Details

Allele Name:
sa18377
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112543 Nonsense 223 1093 7 33
Genomic Location:
Chromosome 7 (position 43270407)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTTCTGTGTGGAGAGGGCGTACCGTGTGCCAGACTTTGGCATGTGGGAA[C/T]GRGGAAGCAAATATAACAATGGAAGCACAGAACTCCATTCAAGGYGAGYT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21041
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112543 Essential Splice Site 627 1093 20 33
Genomic Location:
Chromosome 7 (position 43196755)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTTGGTTTTGTTTACAGTGATTTAAGAGAACAATGATATTTTGGTTTCT[A/G]GGGGGAGCCGATTTAACCCCATCCTGGACATGCTGGCATCTTTCAAGAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27013
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112543 Essential Splice Site 877 1093 28 33
Genomic Location:
Chromosome 7 (position 43180331)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGATGAATTTCCTTCAGTAAACTTGCTTTGTCATGCCTGCATTTCAATCA[G/A]GTGGATTGTTCAAGCCATGAAGCACGAGCTGAAGATTCGCGCTGGAGACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/2oi0ppym