LOC569706

Ensembl ID:
ENSDARG00000078284
Human Orthologue:
PHKB
Human Description:
phosphorylase kinase, beta [Source:HGNC Symbol;Acc:8927]
Mouse Orthologue:
Phkb
Mouse Description:
phosphorylase kinase beta Gene [Source:MGI Symbol;Acc:MGI:97578]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34142 Nonsense Mutation detected in F1 DNA During 2016
sa18377 Nonsense Available for shipment Available now
sa21041 Essential Splice Site Available for shipment Available now
sa27013 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa34142
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112543 Nonsense 101 1093 3 33
Genomic Location (Zv9):
Chromosome 7 (position 43299720)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 41885797
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAGACTCGCTCTACTGCGCTGCCAGCATCTGGGCACTGGCATTGGCATA[C/A]AGGTCAGATACTGATTGGTACTGTACTTGGAAATACATTTTCATAAAATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18377
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112543 Nonsense 223 1093 7 33
Genomic Location (Zv9):
Chromosome 7 (position 43270407)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 41915110
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTTCTGTGTGGAGAGGGCGTACCGTGTGCCAGACTTTGGCATGTGGGAA[C/T]GRGGAAGCAAATATAACAATGGAAGCACAGAACTCCATTCAAGGYGAGYT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21041
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112543 Essential Splice Site 627 1093 20 33
Genomic Location (Zv9):
Chromosome 7 (position 43196755)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 41988762
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTTGGTTTTGTTTACAGTGATTTAAGAGAACAATGATATTTTGGTTTCT[A/G]GGGGGAGCCGATTTAACCCCATCCTGGACATGCTGGCATCTTTCAAGAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27013
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112543 Essential Splice Site 877 1093 28 33
Genomic Location (Zv9):
Chromosome 7 (position 43180331)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 42005186
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGATGAATTTCCTTCAGTAAACTTGCTTTGTCATGCCTGCATTTCAATCA[G/A]GTGGATTGTTCAAGCCATGAAGCACGAGCTGAAGATTCGCGCTGGAGACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link