nkx3-1

Ensembl ID:
ENSDARG00000078280
ZFIN ID:
ZDB-GENE-081104-238
Description:
Novel homeobox domain containing protein [Source:UniProtKB/TrEMBL;Acc:B0S501]
Human Orthologue:
NKX3-1
Human Description:
NK3 homeobox 1 [Source:HGNC Symbol;Acc:7838]
Mouse Orthologue:
Nkx3-1
Mouse Description:
NK-3 transcription factor, locus 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:97352]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa41300 Essential Splice Site, Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa41300
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Essential Splice Site, Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109908 Essential Splice Site 69 211 3 4
ENSDART00000111138 Splice Site None 195 None 5
ENSDART00000112136 Splice Site None 191 None 4
ENSDART00000146056 Splice Site None 214 None 3

The following transcripts of ENSDARG00000078280 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 52536680)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 50269884
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTGTGAGAAAACATGTCATGTTAAAGTTGAATATCGTGTACTTACTTCA[C/A]AGATTCAGCGGATACTTGTCGGACTTCAGAGGGTAAAACTGTGTCGTCGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link