LOC100331716

Ensembl ID:
ENSDARG00000078270
Human Orthologue:
MAST4
Human Description:
microtubule associated serine/threonine kinase family member 4 [Source:HGNC Symbol;Acc:19037]
Mouse Orthologue:
Mast4
Mouse Description:
microtubule associated serine/threonine kinase family member 4 Gene [Source:MGI Symbol;Acc:MGI:19188

Alleles

There are 9 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa5747 Nonsense F2 line generated During 2014
sa2208 Nonsense F2 line generated During 2014
sa25312 Nonsense Mutation detected in F1 DNA During 2014
sa13693 Essential Splice Site Available for shipment Available now
sa9036 Essential Splice Site Mutation detected in F1 DNA During 2014
sa15684 Nonsense Available for shipment Available now
sa20534 Essential Splice Site Mutation detected in F1 DNA During 2014
sa16213 Nonsense Available for shipment Available now
sa13456 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa5747
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088325 Nonsense 61 1327 3 29
ENSDART00000088325 Nonsense 61 1327 3 29
Genomic Location:
Chromosome 5 (position 55555431)
KASP Assay ID:
554-2624.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTATATGGACTAAGAGTTTTCTGYGTTTGTAGAACTGATGGGCGACGCT[G/A]GTCCTTGGCATCTCTTCCCTCTTCTGGCTATGGAACAAACACACCCAGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2208
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088325 Nonsense 61 1327 3 29
ENSDART00000088325 Nonsense 61 1327 3 29
Genomic Location:
Chromosome 5 (position 55555431)
KASP Assay ID:
554-2624.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTATATGGACTAAGAGTTTTCTGYGTTTGTAGAACTGATGGGCGACGCT[G/A]GTCCTTGGCATCTCTTCCCTCTTCTGGCTATGGAACAAACACACCCAGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25312
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088325 Nonsense 110 1327 4 29
Genomic Location:
Chromosome 5 (position 55549903)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTTTCCAGCCCACACCAGATGAGCTGCACTTCCTGTCCAAGCATTTCTA[C/A]ACAGAGAGCATTTCTGGAGATGACCACAGAAGAGTCACTCCTATGCGGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13693
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088325 Essential Splice Site 229 1327 7 29
Genomic Location:
Chromosome 5 (position 55547159)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATGCATGCGTTTAGATGGCCACTTCTGATGTGTTCTGTCATTGTAAWGC[A/C]GTCGACTGAGCGATCGGAGAGTGCAGAGGTGACCTTCATTAAGGAGCTAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9036
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088325 Essential Splice Site 229 1327 7 29
Genomic Location:
Chromosome 5 (position 55547159)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATGCATGCGTTTAGATGGCCACTTCTGATGTGTTCTGTCATTGTAATGC[A/C]GTCGACTGAGCGATCGGAGAGTGCAGAGGTGACCTTCATTAAGGAGCTAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15684
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088325 Nonsense 293 1327 8 29
Genomic Location:
Chromosome 5 (position 55545501)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGGGTCATGCCAAAGAGGGCCAAGGCATCAAGACAGACATCCCACGATR[C/A]ATTATCAGCCAACTTGGCCTGACAAGGGACCCACTTGAGGGTAAGAGGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20534
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088325 Essential Splice Site 608 1327 15 29
Genomic Location:
Chromosome 5 (position 55534760)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGATCACTCTGCTGCTCAGACAGAACCCTATGGAGCGCCTTGGCACTGG[T/C]AAGGGTCCAGAATACTTACAGTGATACTTGCCAAGCACCAAATGTGAGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16213
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088325 Nonsense 1183 1327 28 29
Genomic Location:
Chromosome 5 (position 55522261)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCCTCWGYGTTCCCCGTCTCCCTTGYTGACTCATACTGTCGGAAGCTCC[A/T]AAACTTCTCAGYCCTTCCCTGCCAAAATGCWCTCACCCCCCAMTATTRTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13456
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088325 Nonsense 1212 1327 28 29
Genomic Location:
Chromosome 5 (position 55522174)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCCCCAMTATTGTACGCCATATGGYTCGACCTAAAAGTGCTGAGCCTCCT[C/T]GATCACCACTATTGAAGCGTGTCCAATCTGAGGAAAAACTGTCYCCCTCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/k1tm00ry