si:dkey-181m9.8

Ensembl ID:
ENSDARG00000078267
ZFIN ID:
ZDB-GENE-070912-399
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:B0S5K1]
Human Orthologue:
RNF31
Human Description:
ring finger protein 31 [Source:HGNC Symbol;Acc:16031]
Mouse Orthologue:
Rnf31
Mouse Description:
ring finger protein 31 Gene [Source:MGI Symbol;Acc:MGI:1934704]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2051 Essential Splice Site, Missense F2 line generated During 2017
sa16893 Nonsense Available for shipment Available now
sa19773 Nonsense Available for shipment Available now
sa6845 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa2051
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112873 Missense 169 867 5 21
ENSDART00000148110 Essential Splice Site 168 633 5 16

The following transcripts of ENSDARG00000078267 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 26864242)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 27060438
KASP Assay ID:
554-3007.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACGCCACAAACAAAGCACCTGCCGGCTGAACTGGTTCAACCCAATCCTG[T/C]ATCCTCCTATGGCAGGTCAGTGCTTGTTTGAGTTTCAGATGCAGGCTCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16893
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112873 Nonsense 497 867 12 21
ENSDART00000148110 Nonsense 263 633 7 16

The following transcripts of ENSDARG00000078267 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 26852849)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 27049045
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGTACTTYTCCTCTGTCAKTAAGGAGAAGAATATAGTTCATGCTGTGTG[T/A]CCTCTCTGTAATCTTCCTGATGTACGAGGAGGCCGCAGGGAGGACACCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19773
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112873 Nonsense 541 867 13 21
ENSDART00000148110 Nonsense 307 633 8 16

The following transcripts of ENSDARG00000078267 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 26852389)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 27048585
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAGGTATTATTTGGACTCCCAGATTCATGAGCTTTTTCAGAGGAAACTT[C/T]GAGACAGAGCACTGCAGGAAATGCCCAACTTCCGCTGGTGTGCACATGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6845
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112873 Nonsense 861 867 21 21
ENSDART00000148110 Nonsense 627 633 16 16

The following transcripts of ENSDARG00000078267 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 26840551)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 27036747
KASP Assay ID:
554-4646.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGGCTCCATGGTACTCCATCCTGAACCGGGCAGTTTCTGAGGACTCACAA[C/T]AACTCCTGCTGCTGACCGACTGARGAGCTTAGAGASACTGGGACTTCATA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link