twist2

Ensembl ID:
ENSDARG00000078266
ZFIN ID:
ZDB-GENE-980526-235
Description:
twist2 [Source:RefSeq peptide;Acc:NP_001005956]
Human Orthologue:
TWIST2
Human Description:
twist homolog 2 (Drosophila) [Source:HGNC Symbol;Acc:20670]
Mouse Orthologue:
Twist2
Mouse Description:
twist homolog 2 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:104685]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa5569 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa5569
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114814 Nonsense 92 163 1 2
Genomic Location:
Chromosome 9 (position 46907965)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGTACGCGAGCGGCAACGGACTCAATCGCTGAACGAAGCCTTCGCGTCTT[T/A]GCGCAAAATCATCCCCACGCTCCCCTCGGATAAACTCAGCAAGATCCAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/8k5cexmk