nphp3

Ensembl ID:
ENSDARG00000078261
ZFIN ID:
ZDB-GENE-091204-117
Human Orthologue:
NPHP3
Human Description:
nephronophthisis 3 (adolescent) [Source:HGNC Symbol;Acc:7907]
Mouse Orthologue:
Nphp3
Mouse Description:
nephronophthisis 3 (adolescent) Gene [Source:MGI Symbol;Acc:MGI:1921275]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11865 Nonsense Available for shipment Available now
sa44093 Nonsense Mutation detected in F1 DNA During 2017
sa24446 Nonsense Available for shipment Available now
sa37828 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11865
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110629 Nonsense 142 1302 2 30
ENSDART00000142460 Nonsense 142 1210 3 26
Genomic Location (Zv9):
Chromosome 24 (position 9418639)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 9477523
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGAAGCAAAATACCAAGCCATGGAAAGAGCTGCCACTTTTGAACATGAC[A/T]GAGACAAGGTTAAACGACAGTTTAAGGTATGAGTCTSAGCTGATTCATTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44093
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110629 Nonsense 175 1302 3 30
ENSDART00000142460 Nonsense 175 1210 4 26
Genomic Location (Zv9):
Chromosome 24 (position 9420321)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 9479205
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGAAATTCAGGATTTGCTGCGGGCAAAACGAGATCTGGAGTCAAAACTT[C/T]AACAGCTGCAGGCGCAAGGCATTCAGATTTATGACCCAGCAGACTCAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24446
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110629 Nonsense 386 1302 8 30
ENSDART00000142460 Nonsense 393 1210 8 26
Genomic Location (Zv9):
Chromosome 24 (position 9426789)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 9485673
KASP Assay ID:
2261-8443.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCGACAGAAAAGGTGAAAAGGAAGAGGTGTCTACTCTCAGCCCAGCCACC[A/T]GAGACCTGCTAGAGAGAGTGAACAAGGCTGACAGAAGTGCCAAACTTAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37828
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110629 Nonsense 1250 1302 29 30
ENSDART00000142460 Nonsense 1163 1210 26 26
Genomic Location (Zv9):
Chromosome 24 (position 9464256)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 9523140
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCCATGCTAATCGCTCTCTTACTTCCTCAGTTACGAAGAGGGTGATTTC[G/T]AGAAGGCTGCTGAACTCTACAAGCGAGCAATGGAAATTAAAGAGGCCGAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link