LOC100333757

Ensembl ID:
ENSDARG00000078258
Human Orthologue:
GGT5
Human Description:
gamma-glutamyltransferase 5 [Source:HGNC Symbol;Acc:4260]
Mouse Orthologue:
Ggt5
Mouse Description:
gamma-glutamyltransferase 5 Gene [Source:MGI Symbol;Acc:MGI:1346063]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14936 Essential Splice Site Available for shipment Available now
sa11520 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa14936
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114210 Essential Splice Site 95 553 2 12
Genomic Location:
Chromosome 10 (position 42934889)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGCATGGGCTTGGGCGGAGGCTCCATCTTTACCATTATGGACAACACAG[G/A]TAYAGTATTACTGAACATTCAACCTCCCGAATTTCAGTAAWAATTGCATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11520
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114210 Essential Splice Site 194 553 5 12
Genomic Location:
Chromosome 10 (position 42950005)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCTGTCTGCTTTTGCTCATKTTTTGTTGTGTKTGTCTATATATTCTCTA[G/A]TGAACTGTTCTGCAAAAACAAYAACACAGAAGTCTTGGGCCMAGGGGACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/wh6f8r7x