si:ch211-198a12.4

Ensembl ID:
ENSDARG00000078254
ZFIN ID:
ZDB-GENE-090312-123
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:B8A692]
Human Orthologue:
TRIM65
Human Description:
tripartite motif-containing 65 [Source:HGNC Symbol;Acc:27316]
Mouse Orthologue:
Trim65
Mouse Description:
tripartite motif-containing 65 Gene [Source:MGI Symbol;Acc:MGI:2442815]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42173 Nonsense Mutation detected in F1 DNA During 2017
sa38931 Nonsense Mutation detected in F1 DNA During 2017
sa1784 Nonsense Available for shipment Available now
sa22269 Essential Splice Site Available for shipment Available now
sa31919 Essential Splice Site Available for shipment Available now
sa42174 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa42173
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108779 Nonsense 85 506 1 6
ENSDART00000136024 Nonsense 68 419 1 6
Genomic Location (Zv9):
Chromosome 13 (position 18582179)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 18402214
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTCTGACTTGCTTAACCTCCTTTTGTGAAGCGCATCTCCAGGCTCATTA[T/G]GAGTATCCAGCTCTCATGAAGCACAAACTGGTGGCGGCGACAGGGCAACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38931
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108779 Nonsense 112 506 1 6
ENSDART00000136024 Nonsense 95 419 1 6
Genomic Location (Zv9):
Chromosome 13 (position 18582258)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 18402293
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGTGGCGGCGACAGGGCAACTGCGTGAAAAGATCTGCGGCGAACATGAC[A/T]AACTTCTGGAGGTTTTCTGTCGTTCTGACCAAATGTGTGTTTGTGTTTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1784
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108779 Nonsense 239 506 3 6
ENSDART00000136024 Nonsense 222 419 3 6
Genomic Location (Zv9):
Chromosome 13 (position 18586413)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 18406448
KASP Assay ID:
554-1777.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACCAATGCAGAGAGACATTTGGCCAGACTAGAGGAAGAGATTACCCTGT[T/A]AAGGAAGAAACACACTGACTTGGAGCAGCTCTCACAGTCTGATGATCACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22269
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108779 Essential Splice Site 333 506 5 6
ENSDART00000136024 Essential Splice Site 316 419 5 6
ENSDART00000108779 Essential Splice Site 333 506 5 6
ENSDART00000136024 Essential Splice Site 316 419 5 6
Genomic Location (Zv9):
Chromosome 13 (position 18588501)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 18408536
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAAAATTCTCCAGACTGTGGACCCAGCAAAACGAGAGGAGTTCTTTGAAT[G/T]TAAGTTCAGAAATAGTGAGATTCTCATTTTATATAAACACATTGTTGATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31919
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108779 Essential Splice Site 333 506 5 6
ENSDART00000136024 Essential Splice Site 316 419 5 6
ENSDART00000108779 Essential Splice Site 333 506 5 6
ENSDART00000136024 Essential Splice Site 316 419 5 6
Genomic Location (Zv9):
Chromosome 13 (position 18588501)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 18408536
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAAAATTCTCCAGACTGTGGACCCAGCAAAACGAGAGGAGTTCTTTGAAT[G/T]TAAGTTCAGAAATAGTGAGATTCTCATTTTATATAAACACATTGTTGATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42174
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108779 Nonsense 390 506 6 6
ENSDART00000136024 Nonsense 373 419 6 6
Genomic Location (Zv9):
Chromosome 13 (position 18588751)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 18408786
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTTCGACTATTGGCAACAGGCACTGTGTAAGCCGGGTCTGGCAGGAGGA[C/T]GATATTACTGGGAGCTGGACTGGAGAGGCACTGAAGTGGACATTGCTGTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link