si:ch211-113e8.3

Ensembl ID:
ENSDARG00000078251
ZFIN ID:
ZDB-GENE-090312-74
Description:
Novel protein similar to H.sapiens testis-specific kinase [Source:UniProtKB/TrEMBL;Acc:B7ZDC6]
Human Orthologue:
TESK1
Human Description:
testis-specific kinase 1 [Source:HGNC Symbol;Acc:11731]
Mouse Orthologue:
Tesk1
Mouse Description:
testis specific protein kinase 1 Gene [Source:MGI Symbol;Acc:MGI:1201675]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1979 Essential Splice Site F2 line generated During 2017
sa11795 Nonsense Available for shipment Available now
sa32723 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa1979
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112133 Essential Splice Site 251 657 7 10
ENSDART00000140619   None 75 None 2
ENSDART00000146680 Essential Splice Site 231 259 7 8
Genomic Location (Zv9):
Chromosome 1 (position 40609509)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 39498918
KASP Assay ID:
554-2741.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATTATTGCTCGAATTGAGGCTGACCCAGATATCCTCCCACGGACAGAGG[T/C]ACATACAACTGTACAGCAGAACATGAAGCACAGAATCAGGCTTAGAATCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11795
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112133 Nonsense 419 657 10 10
ENSDART00000140619   None 75 None 2
ENSDART00000146680   None 259 None 8
Genomic Location (Zv9):
Chromosome 1 (position 40604658)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 39494067
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGGAGCCCAGGGCTTCGAGGACCCCCTCGAAGGTGTCGGTCYCTGCCCTG[C/A]ACCCCTGAACTAGGACGAMAGTTACCCTTCAGAGATCAAGAGGTAGAAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32723
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112133 Nonsense 455 657 10 10
ENSDART00000140619   None 75 None 2
ENSDART00000146680   None 259 None 8
Genomic Location (Zv9):
Chromosome 1 (position 40604552)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 39493961
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAGTGAAGAACTGGGCCAGGAAACGAAAGACAAAGAGTTGGAAGGACAA[C/T]AAGATGCGGTGGAGGACTCAGGCCTGGTTCTGGACTTAGATATGGTGTCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link