UNC13D

Ensembl ID:
ENSDARG00000078249
Description:
unc-13 homolog D (C. elegans) [Source:HGNC Symbol;Acc:23147]
Human Orthologue:
UNC13D
Human Description:
unc-13 homolog D (C. elegans) [Source:HGNC Symbol;Acc:23147]
Mouse Orthologue:
Unc13d
Mouse Description:
unc-13 homolog D (C. elegans) Gene [Source:MGI Symbol;Acc:MGI:1917700]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35355 Essential Splice Site Mutation detected in F1 DNA During 2018
sa44772 Nonsense Mutation detected in F1 DNA During 2018
sa30963 Nonsense Mutation detected in F1 DNA During 2018
sa10295 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa35355
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110290 Essential Splice Site 21 1108 1 35
Genomic Location (Zv9):
Chromosome 12 (position 37141493)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 35844975
GRCz11 12 36517716
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGATGGGGCATCCAGTCAAGGGGAAAATCTGCTTCTTCCTCCTAAAGAG[G/A]TCAGTAAAATGTGTGCCTGTTAAAAAACGTTTCTCTTTTGAGGGTCAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44772
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110290 Nonsense 86 1108 5 35
Genomic Location (Zv9):
Chromosome 12 (position 37147792)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 35838676
GRCz11 12 36511417
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCTGCAGCTCAAACCGCTGTACAAGGAGCTTCTGTACACAATCACTCAT[C/T]GATTAGGAAAACCACACATAAAACAGCAATACAGTCAGAAGCAGTTTCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30963
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110290 Nonsense 280 1108 12 35
Genomic Location (Zv9):
Chromosome 12 (position 37153721)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 35832747
GRCz11 12 36505488
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATGTATGTGTGTGTTGTGTGCAGGACCTGCATTGCACAGAGGACACGTG[G/A]TATAACCTGGAGCCCCGAACAGAGACTTACCCAGACAGAGGACGATGTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10295
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110290 Nonsense 568 1108 21 35
Genomic Location (Zv9):
Chromosome 12 (position 37164705)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 35821763
GRCz11 12 36494504
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAGCAGAGGARCTWCGAGCTACTCTCTCTCAGCTTGAGAATCAAATGGAT[C/T]AGCCGCTGGCAAACMGCYTRTTTCCAGTGTATCTCTCCTTGCAAACGATC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link