si:ch73-46j18.4

Ensembl ID:
ENSDARG00000078245
ZFIN ID:
ZDB-GENE-091117-38
Human Orthologue:
GAL3ST1
Human Description:
galactose-3-O-sulfotransferase 1 [Source:HGNC Symbol;Acc:24240]
Mouse Orthologue:
Gal3st1
Mouse Description:
galactose-3-O-sulfotransferase 1 Gene [Source:MGI Symbol;Acc:MGI:1858277]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38769 Essential Splice Site Mutation detected in F1 DNA During 2017
sa11615 Nonsense Available for shipment Available now
sa9400 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa38769
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112173 Essential Splice Site 36 413 1 2
ENSDART00000144216   None 418 None 3
Genomic Location (Zv9):
Chromosome 10 (position 1752711)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 1698267
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTCCTATACTGCACCGACCCTCCTGGCAACACACAGGTATGCCGACAAG[A/T]CACATATACATTAATATACAGTTGAAGTCAGAATTATTAGCCCCCCTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11615
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112173 Nonsense 345 413 2 2
ENSDART00000144216 Nonsense 346 418 3 3
Genomic Location (Zv9):
Chromosome 10 (position 1749044)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 1694600
KASP Assay ID:
2260-2719.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACGCGGAGATGGAGGCSAWCTGCATCGACRGAGGCAGAGCTGTGGAGGCT[A/T]AAGACATCACGGACACACACATGAAGCCCTGGCAGCCGCTCGGGAAGGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9400
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112173   None 413 None 2
ENSDART00000144216 Nonsense 417 418 3 3
Genomic Location (Zv9):
Chromosome 10 (position 1748830)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 1694386
KASP Assay ID:
2260-2718.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTCACGCGGCTGTGGGGATGGTTTARGGATAGTGTTGTGCAGTTTGGGT[T/A]GAGCTAGGTTTATATRTAARATGTTTATATTCGTTATGAATGTGACTATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link