si:ch211-197l9.2

Ensembl ID:
ENSDARG00000078244
ZFIN ID:
ZDB-GENE-091204-369
Human Orthologues:
C20orf117, C6orf174, KIAA0802, RP3-403A15.5
Human Descriptions:
C6orf174 protein [Source:UniProtKB/TrEMBL;Acc:A5PLQ8]
chromosome 20 open reading frame 117 [Source:HGNC Symbol;Acc:16111]
chromosome 6 open reading frame 174 [Source:HGNC Symbol;Acc:21494]
KIAA0802 [Source:HGNC Symbol;Acc:29121]
Mouse Orthologues:
1110012J17Rik, 6330407J23Rik, 9830001H06Rik
Mouse Descriptions:
RIKEN cDNA 1110012J17 gene Gene [Source:MGI Symbol;Acc:MGI:1915867]
RIKEN cDNA 6330407J23 gene Gene [Source:MGI Symbol;Acc:MGI:1914662]
RIKEN cDNA 9830001H06 gene Gene [Source:MGI Symbol;Acc:MGI:2444575]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa44020 Nonsense Mutation detected in F1 DNA During 2017
sa29961 Nonsense Mutation detected in F1 DNA During 2017
sa29962 Nonsense Mutation detected in F1 DNA During 2017
sa10465 Nonsense Available for shipment Available now
sa6745 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa44020
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115417   None 744 None 15
ENSDART00000142953   None 545 None 4
ENSDART00000144485 Nonsense 234 523 4 4
Genomic Location (Zv9):
Chromosome 23 (position 31219148)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 31054038
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAAAGTTCACTTGCGACTGGTGGAAGAGGAAGCCACGCTGCTGAGTCGT[C/T]GAATTGTGGAGCTGGAGGTGGAGAACCGTGGGTTGCGGGCAGAGATGAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29961
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115417 Nonsense 48 744 2 15
ENSDART00000142953   None 545 None 4
ENSDART00000144485   None 523 None 4
Genomic Location (Zv9):
Chromosome 23 (position 31221389)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 31056279
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGTATTGTCAGAATGATCTTCACCTCTTAAAGGACACAGCGTGCAAGTA[C/A]AACCTGCAAGAGAAGTGCAACAGTCAGGTATGGAAAAGGAGGATGCCCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29962
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115417 Nonsense 249 744 9 15
ENSDART00000142953   None 545 None 4
ENSDART00000144485   None 523 None 4
Genomic Location (Zv9):
Chromosome 23 (position 31227768)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 31062658
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACTTTCCTTTACAGTAAATGGGGGAGAGAGAGAACTGAGGAAGCAGGAT[T/A]GAGAAGAACAAATGAATTATTTTAGATATTATGTTCTATTTTTGGATGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10465
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115417 Nonsense 310 744 12 15
ENSDART00000142953 Nonsense 125 545 3 4
ENSDART00000144485   None 523 None 4
Genomic Location (Zv9):
Chromosome 23 (position 31230610)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 31065500
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AASCCAACAAGAACTGGAAGTACMTCAGTCATGAAGCTGCCCTTCTTGAC[C/T]RAGAGGACGCCTGCAAGACTTGGGACTGTCCTATCATGCCTCCCAGTTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6745
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115417   None 744 None 15
ENSDART00000142953 Nonsense 464 545 3 4
ENSDART00000144485   None 523 None 4
Genomic Location (Zv9):
Chromosome 23 (position 31231627)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 31066517
KASP Assay ID:
554-4794.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCGGTCGAGGAGAGAARACCAACRTAGAGATGGAGAAAGCGCCAGTGGCT[C/T]GAAGGGATCATGTTAGTCTGGCGGCGGGTTCAAAGAAATCTGAACACCCY
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link