MAP7 (2 of 2)

Ensembl ID:
ENSDARG00000078241
Description:
microtubule-associated protein 7 [Source:HGNC Symbol;Acc:6869]
Human Orthologue:
MAP7
Human Description:
microtubule-associated protein 7 [Source:HGNC Symbol;Acc:6869]
Mouse Orthologue:
Mtap7
Mouse Description:
microtubule-associated protein 7 Gene [Source:MGI Symbol;Acc:MGI:1328328]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39155 Nonsense Mutation detected in F1 DNA During 2016
sa23031 Nonsense Mutation detected in F1 DNA During 2016
sa14185 Nonsense Available for shipment Available now
sa36369 Nonsense Mutation detected in F1 DNA During 2016
sa36368 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa39155
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110383 Nonsense 127 574 4 14
Genomic Location (Zv9):
Chromosome 17 (position 15905562)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 16056390
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCGAGCGTGGCTGGCTGGCGAGGGAGGAACGGGCCAAGCAGATCTATGAG[A/T]AACACCTGGAGGAGCGACGCAAGAAACTGGAGGAGCAGCGGCAAAGAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23031
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110383 Nonsense 227 574 6 14
Genomic Location (Zv9):
Chromosome 17 (position 15903740)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 16054568
KASP Assay ID:
2261-0818.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTGTGGGAAAGTGCCGAACAGACCTGGAGGCTCAAACGTCACCATCCGC[A/T]GAACCACCAACAGAGAGCTGGTGGGAGTTTGCATTCATTTTTACTCAATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14185
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110383 Nonsense 322 574 8 14
Genomic Location (Zv9):
Chromosome 17 (position 15901046)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 16051874
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACMTGAACCATCCTCCAGTCATACAMAATCTGAAAAAACACGATGTCTG[A/T]AAGAMAATTCACTCCAGTTGAACACAGCTAGTAATRKGCCTCTGCATCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36369
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110383 Nonsense 350 574 9 14
Genomic Location (Zv9):
Chromosome 17 (position 15899872)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 16050700
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGGTCTTGGTTAAATAGGTTTTTCCATGTTTTCACTTACAGGACCAAGC[C/T]AAATAGCTGACAGTGCTCAAGTCAGACCTACTTCTTGGACTAAAGACCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36368
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110383 Essential Splice Site 490 574 11 14
Genomic Location (Zv9):
Chromosome 17 (position 15897214)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 16048042
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAGATTCGTTTCCAGAAAGAAAAGGCTGAACGCCAAGAAAGAAAAAAGG[T/A]AAGATTTATTTTAGAAAGTCAGTCACATACAGTTGAACTAACTGTACAAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link