MAP7 (2 of 2)

Ensembl ID:
ENSDARG00000078241
Description:
microtubule-associated protein 7 [Source:HGNC Symbol;Acc:6869]
Human Orthologue:
MAP7
Human Description:
microtubule-associated protein 7 [Source:HGNC Symbol;Acc:6869]
Mouse Orthologue:
Mtap7
Mouse Description:
microtubule-associated protein 7 Gene [Source:MGI Symbol;Acc:MGI:1328328]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23031 Nonsense Mutation detected in F1 DNA During 2014
sa14185 Nonsense Available for shipment Available now
sa7825 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa23031
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110383 Nonsense 227 574 6 14
Genomic Location:
Chromosome 17 (position 15903740)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTGTGGGAAAGTGCCGAACAGACCTGGAGGCTCAAACGTCACCATCCGC[A/T]GAACCACCAACAGAGAGCTGGTGGGAGTTTGCATTCATTTTTACTCAATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14185
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110383 Nonsense 322 574 8 14
Genomic Location:
Chromosome 17 (position 15901046)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACMTGAACCATCCTCCAGTCATACAMAATCTGAAAAAACACGATGTCTG[A/T]AAGAMAATTCACTCCAGTTGAACACAGCTAGTAATRKGCCTCTGCATCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7825
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110383 Essential Splice Site 508 574 13 14
Genomic Location:
Chromosome 17 (position 15896430)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTTTTGTTTTCAYCCCATCTAGTAGCCCTWCTCACTTTCTGTCCTCTTT[A/C]GAAAGCCGCATYAGTGAAGGACAACTTGCCTTGTGAGAACGTGAACCCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/nccc5ipt