B1WB97_DANRE

Ensembl ID:
ENSDARG00000078233
Description:
LOC556726 protein [Source:UniProtKB/TrEMBL;Acc:B1WB97]
Human Orthologue:
CTNND1
Human Description:
catenin (cadherin-associated protein), delta 1 [Source:HGNC Symbol;Acc:2515]
Mouse Orthologue:
Ctnnd1
Mouse Description:
catenin (cadherin associated protein), delta 1 Gene [Source:MGI Symbol;Acc:MGI:105100]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa14184 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14184
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106048 Nonsense 877 904 17 18
Genomic Location:
Chromosome 1 (position 44627448)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAATGCGATGGCTGTGCTAATTCTAATGTGTGTGTGGTGGCAGACGCTTA[T/A]TCAACAATAGACCAGCGAGGACGKAGAAACACTTTAGATGACACTCTGGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/p8513l1h