cspg4

Ensembl ID:
ENSDARG00000078227
ZFIN ID:
ZDB-GENE-050519-1
Human Orthologues:
AC010724.5, AC011295.1, AC044860.1, AC135995.2, CSPG4, CSPG4P5
Human Descriptions:
chondroitin sulfate proteoglycan 4 pseudogene 5 [Source:HGNC Symbol;Acc:29403]
chondroitin sulfate proteoglycan 4 [Source:HGNC Symbol;Acc:2466]
Mouse Orthologue:
Cspg4
Mouse Description:
chondroitin sulfate proteoglycan 4 Gene [Source:MGI Symbol;Acc:MGI:2153093]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14510 Nonsense Available for shipment Available now
sa24601 Nonsense Mutation detected in F1 DNA During 2014
sa15270 Nonsense Available for shipment Available now
sa12954 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14510
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112782 Nonsense 1639 2305 8 10
Genomic Location:
Chromosome 25 (position 6864143)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAATCAAACCTAACCAGCGTGGACAGTTTGAGGAGATCACCAGATTCACA[C/T]AAACTGAGGTAAATGTTGTASATTTSTAAATATGTCATAATGTACTAGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24601
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112782 Nonsense 1821 2305 10 10
Genomic Location:
Chromosome 25 (position 6861801)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCAGCCTGGTGCCGTGGTTTTAGAGGAGATCTTTTTGATCTCCCTCAGA[C/T]GACGAGACTCAAACCCGCCAGAGCTCGCAAGCTTGGACCTGCTTCTGGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15270
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112782 Nonsense 1982 2305 10 10
Genomic Location:
Chromosome 25 (position 6861316)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTCCCGTTGAGGAGGAGGTACTCTATAAAATAACCAACGTMCCAAAATA[T/A]GCTGCTGTAATGGTAGACAGACAGCCAACCTCAGCTTTCACACAGARGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12954
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112782 Nonsense 2062 2305 10 10
Genomic Location:
Chromosome 25 (position 6861077)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAAAATCCCCTGCTACCCAGAGGTGCTACTGTGCTTGTARACAGAAAGT[T/A]GTTGGAYGCTWCTCCTCTGGCCAACAAAACCAGAACATCTCCAACCTTCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/3lbghucx