AATK (1 of 2)

Ensembl ID:
ENSDARG00000078222
Description:
apoptosis-associated tyrosine kinase [Source:HGNC Symbol;Acc:21]
Human Orthologue:
AATK
Human Description:
apoptosis-associated tyrosine kinase [Source:HGNC Symbol;Acc:21]
Mouse Orthologue:
Aatk
Mouse Description:
apoptosis-associated tyrosine kinase Gene [Source:MGI Symbol;Acc:MGI:1197518]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20139 Essential Splice Site Mutation detected in F1 DNA During 2014
sa11750 Nonsense Available for shipment Available now
sa6918 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa20139
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110080 Essential Splice Site 189 1608 5 14
Genomic Location:
Chromosome 3 (position 52531240)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAGTGTACAAGAGCAGATGCAGTTCCTGGAAGAGGTCCAACCTTATCGG[T/A]AAACACTTTTTATCTTGCACTCAATTTTCACAAAGAAAATTAAATAAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11750
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110080 Nonsense 667 1608 11 14
Genomic Location:
Chromosome 3 (position 52523911)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATATTTATCTTCCAATGACAGGCAACATTTTCAATGTGAACAGTCACCA[A/T]AAAAAGGACCAGATGTTAATTTGATAAGAAGACAGGGTTCAGATTCAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6918
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110080 Nonsense 744 1608 11 14
Genomic Location:
Chromosome 3 (position 52523680)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGAAAGAAGTAGGGCAAATGAGGCCTATTATGACATGATGAGCCCTTTA[C/T]AAAAAAATGTGCCTAGRCCGCACTACATGAGCATTGATATTGATGCTGGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/r1n29ljk