si:ch211-204d2.4

Ensembl ID:
ENSDARG00000078221
ZFIN ID:
ZDB-GENE-081105-163
Description:
pleckstrin homology domain-containing family A member 2 [Source:RefSeq peptide;Acc:NP_001121835]
Human Orthologue:
PLEKHA2
Human Description:
pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 2 [Source
Mouse Orthologue:
Plekha2
Mouse Description:
pleckstrin homology domain-containing, family A (phosphoinositide binding specific) member 2 Gene [S

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34317 Nonsense Available for shipment Available now
sa21208 Essential Splice Site Available for shipment Available now
sa34318 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa34317
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113407 Nonsense 60 391 2 11
ENSDART00000133532 Nonsense 60 391 3 12
Genomic Location (Zv9):
Chromosome 8 (position 11539439)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 11129685
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCTTAAAAAACAGAACCTACCTGTTGGAACGGAGCATGTTGGAAGTTTA[C/T]GACTCAGTTACATTTCAAAGGTTTGGTGCTGGCGTGTAACAATGACTATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21208
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113407 Essential Splice Site 66 391 2 11
ENSDART00000133532 Essential Splice Site 66 391 3 12
Genomic Location (Zv9):
Chromosome 8 (position 11539460)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 11129664
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGTTGGAACGGAGCATGTTGGAAGTTTACGACTCAGTTACATTTCAAAG[G/A]TTTGGTGCTGGCGTGTAACAATGACTATATACTGCATTTTTATTACTTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34318
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113407 Nonsense 212 391 7 11
ENSDART00000133532 Nonsense 212 391 8 12
Genomic Location (Zv9):
Chromosome 8 (position 11548122)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 11121002
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTCTTTCAGAGGAAAAGCTGGAAGAGGAGATTTTTTATTTTGGATGAC[C/T]AAACTGTGAGCTACTACAAATCTGAAATGGTGAGATGCTGGAAAGGTGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link