si:ch73-22b20.2

Ensembl ID:
ENSDARG00000078216
ZFIN ID:
ZDB-GENE-081104-264
Description:
Novel protein similar to H.sapiens EPS15, epidermal growth factor receptor pathway substrate 15 (EPS
Human Orthologue:
EPS15
Human Description:
epidermal growth factor receptor pathway substrate 15 [Source:HGNC Symbol;Acc:3419]
Mouse Orthologue:
Eps15
Mouse Description:
epidermal growth factor receptor pathway substrate 15 Gene [Source:MGI Symbol;Acc:MGI:104583]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa34359 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa34359
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098692 Essential Splice Site 404 1039 13 26
ENSDART00000124257 Essential Splice Site 404 1024 13 24
Genomic Location (Zv9):
Chromosome 8 (position 17057784)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 16502672
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATCAAAGACAGGGAGGAAACTATTCGACAAAGGACCAGCGAAGTCCAGG[T/C]AAGAACCCATTCATATTTTAATGCAAATAAACGTATTTTGATTTAGCTGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • IgE grass sensitization: A genome-wide meta-analysis of genetic variants associated with allergic rhinitis and grass sensitization and their interaction with birth order. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link