si:ch73-317k23.2

Ensembl ID:
ENSDARG00000078215
ZFIN ID:
ZDB-GENE-100922-22
Description:
Novel protein similar to H.sapiens ZFYVE20, zinc finger, FYVE domain containing 20 (ZFYVE20) [Source
Human Orthologue:
ZFYVE20
Human Description:
zinc finger, FYVE domain containing 20 [Source:HGNC Symbol;Acc:20759]
Mouse Orthologue:
Zfyve20
Mouse Description:
zinc finger, FYVE domain containing 20 Gene [Source:MGI Symbol;Acc:MGI:1925537]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa18934 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa18934
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114683 Nonsense 348 736 9 14
ENSDART00000144493 Nonsense 353 512 10 13
Genomic Location (Zv9):
Chromosome 8 (position 55351080)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 53276723
KASP Assay ID:
2260-1256.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGTCTGCTTTAGTAAGAAGATCCTAACACTGGGGCTGAAAGAGGAGCTT[C/T]AGCCTCATCCCAAAGCCCTGCAGCTGCAGAGGATGGTGCGATACACAGCC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link