ESPNL

Ensembl ID:
ENSDARG00000078211
Description:
espin-like [Source:HGNC Symbol;Acc:27937]
Human Orthologue:
ESPNL
Human Description:
espin-like [Source:HGNC Symbol;Acc:27937]
Mouse Orthologue:
Espnl
Mouse Description:
espin-like Gene [Source:MGI Symbol;Acc:MGI:2685402]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20705 Nonsense Available for shipment Available now
sa33872 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa20705
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108831 Nonsense 179 500 1 1
Genomic Location (Zv9):
Chromosome 6 (position 27045305)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 27346516
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAACCTGAAGTCCAACTTTGAGAATCAAAATGATTCTTCATTGGAGGATT[T/A]AATGAGGGTTGGATCATTGGTTCAACAAGTCCAACAACCAGTTAAGAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33872
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108831 Nonsense 245 500 1 1
Genomic Location (Zv9):
Chromosome 6 (position 27045504)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 27346715
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTACAACCCTGAGAAAAGAACGTATTGTGGTGTTGTTCTTGGGTCACTG[G/A]AAGAAGTCTGCTTATACTGTAACCGTAAGAAATGCTCAGAGGAAACAAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link