
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
ESPNL
- Ensembl ID:
- ENSDARG00000078211
- Description:
- espin-like [Source:HGNC Symbol;Acc:27937]
- Human Orthologue:
- ESPNL
- Human Description:
- espin-like [Source:HGNC Symbol;Acc:27937]
- Mouse Orthologue:
- Espnl
- Mouse Description:
- espin-like Gene [Source:MGI Symbol;Acc:MGI:2685402]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa20705 | Nonsense | Available for shipment | Available now |
sa33872 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa20705
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000108831 | Nonsense | 179 | 500 | 1 | 1 |
- Genomic Location (Zv9):
- Chromosome 6 (position 27045305)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 6 27346516 GRCz11 6 27337077 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AAACCTGAAGTCCAACTTTGAGAATCAAAATGATTCTTCATTGGAGGATT[T/A]AATGAGGGTTGGATCATTGGTTCAACAAGTCCAACAACCAGTTAAGAATG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa33872
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000108831 | Nonsense | 245 | 500 | 1 | 1 |
- Genomic Location (Zv9):
- Chromosome 6 (position 27045504)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 6 27346715 GRCz11 6 27337276 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AGTACAACCCTGAGAAAAGAACGTATTGTGGTGTTGTTCTTGGGTCACTG[G/A]AAGAAGTCTGCTTATACTGTAACCGTAAGAAATGCTCAGAGGAAACAAAG
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: