LOC571108

Ensembl ID:
ENSDARG00000078210
Human Orthologue:
TULP1
Human Description:
tubby like protein 1 [Source:HGNC Symbol;Acc:12423]
Mouse Orthologue:
Tulp1
Mouse Description:
tubby like protein 1 Gene [Source:MGI Symbol;Acc:MGI:109571]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa16810 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa16810
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112344 Essential Splice Site 69 409 3 11
Genomic Location:
Chromosome 6 (position 54503212)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATRTTTCAGATAAATGGAGAAAAGCCTGAAACCAAGAGTAAAAAGAAAG[G/A]TAATGTWTGARAACTTTTCYCTATGCGTGTCTGTTTTAWGATTCAGAATA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/df7a49pk