si:ch211-246b8.2

Ensembl ID:
ENSDARG00000078208
ZFIN ID:
ZDB-GENE-070705-137
Description:
Novel NACHT domain containing protein [Source:UniProtKB/TrEMBL;Acc:A5WVK8]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa40328 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa40328
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114511 Essential Splice Site 61 338 3 3
ENSDART00000132977 Essential Splice Site 106 641 4 4
Genomic Location (Zv9):
Chromosome 4 (position 49129617)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 34408088
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATCTTTACCCTCACACTCATTGATTCTTTGTGTTGTTGTTGTTCCTGCA[G/A]TGTGGATAGAGATGATCAGACTGGAGACCTGCAGCAGGATTCACTCCAAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link