ino80da

Ensembl ID:
ENSDARG00000078199
ZFIN ID:
ZDB-GENE-091204-416
Human Orthologue:
INO80D
Human Description:
INO80 complex subunit D [Source:HGNC Symbol;Acc:25997]
Mouse Orthologue:
Ino80d
Mouse Description:
INO80 complex subunit D Gene [Source:MGI Symbol;Acc:MGI:3027003]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa9026 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa9026
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112992 Essential Splice Site 433 922 None 10
ENSDART00000139846 Essential Splice Site 76 560 None 6
ENSDART00000141527   None 164 None 3
Genomic Location (Zv9):
Chromosome 9 (position 1069787)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 1037278
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGGCACAGCTCATTCAGAAACTCAGCAGGAGCTCGCAGACCTCCAGCTGG[T/A]GCGTTTGCTGTCCATTCTTATGTTTTKATTTWTATACAGTTTTATTTCYT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link