gdpd4a

Ensembl ID:
ENSDARG00000078196
ZFIN ID:
ZDB-GENE-091204-436
Human Orthologue:
GDPD4
Human Description:
glycerophosphodiester phosphodiesterase domain containing 4 [Source:HGNC Symbol;Acc:24849]
Mouse Orthologue:
Gdpd4
Mouse Description:
glycerophosphodiester phosphodiesterase domain containing 4 Gene [Source:MGI Symbol;Acc:MGI:3606573]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa28972 Nonsense Mutation detected in F1 DNA During 2017
sa23223 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa28972
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111380 Nonsense 10 525 2 14
Genomic Location (Zv9):
Chromosome 18 (position 6411135)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 3229025
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGAAGCTGGGGAAGCTAAAGGTGGTGCGGCGGCAGCTGCTGCAGCGCTA[T/G]GAGCACCAGCCATTTGTCTCCTGTCTGGCCGGTCTGTACGGCTGCCAGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23223
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111380 Essential Splice Site 44 525 2 14
Genomic Location (Zv9):
Chromosome 18 (position 6411239)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 3228921
KASP Assay ID:
2261-1799.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGATACCAGCGCGCCAAAGCCCAGCCGGGAGAGTGCTGCTGCAGCCGGG[T/C]CAGCAAACAGACACTGATACACCAAACACTGCTTCATTCCTTCAGGGTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link