si:ch211-67e16.3

Ensembl ID:
ENSDARG00000078193
ZFIN ID:
ZDB-GENE-070912-310
Description:
Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:A9JRX3]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12843 Essential Splice Site Available for shipment Available now
sa41378 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa12843
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110348 Essential Splice Site 188 242 3 6
ENSDART00000143837 Essential Splice Site 186 240 3 5

The following transcripts of ENSDARG00000078193 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 14290843)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 14043408
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTCTCTTTCTACAGCATCATTGTAACTGTGACCTACATCAGATTGAGGG[T/C]AAAGCATTTWCAGAATTTTTATTGCCTGTGTCNNNNTGTTGGGTTTTATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41378
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110348 Nonsense 222 242 5 6
ENSDART00000143837 Nonsense 220 240 5 5

The following transcripts of ENSDARG00000078193 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 14295400)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 14047965
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAATGTAAAGCGGCATGATATTGACAACACAGAATACGTGGACATGCGT[G/T]AATTGCTGAAACGAGGAGGATCCCACAGAGATATGAACCACAACTCTCAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link