ENSDARG00000078192

Ensembl ID:
ENSDARG00000078192
Mouse Orthologue:
4930485B16Rik
Mouse Description:
RIKEN cDNA 4930485B16 gene Gene [Source:MGI Symbol;Acc:MGI:1922208]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13101 Nonsense Available for shipment Available now
sa5260 Essential Splice Site Mutation detected in F1 DNA During 2014
sa11516 Nonsense Available for shipment Available now
sa10024 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13101
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113056 Nonsense 368 755 9 22
ENSDART00000114054 None None 194 None 8
Genomic Location:
Chromosome 4 (position 17528916)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAGAGGCTCTACAAGACAAATCAGTCAGSCCTCTGCAGACTGGCTTGCCT[G/T]AGGAATTTGAGGTCCAGGTTGTGGTACTGGAGCTTGTYTCRGCTGGCATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5260
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113056 Essential Splice Site 416 755 11 22
ENSDART00000114054 None None 194 None 8
Genomic Location:
Chromosome 4 (position 17530486)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTAAAAGCAGTCACTTCTGTTTCCTCTCTTTTTGAAGAGGCTGTCACTGG[T/C]GAGTATTGCATTTAATTTCCCTTTTATTCYTCGCCACTCTAATTTTTTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11516
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113056 Nonsense 435 755 12 22
ENSDART00000114054 Nonsense 33 194 2 8
Genomic Location:
Chromosome 4 (position 17530637)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGATTTCAGTAGATGCTGCWGTRAAGTTTGTGAAGCAGCTCTTCAGATA[T/G]GAACAATGGAGCACATTCCGCTCCCTTTCCACTGCTCTTTTGTCWGTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10024
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113056 Nonsense 568 755 15 22
ENSDART00000114054 Nonsense 167 194 7 8
Genomic Location:
Chromosome 4 (position 17531781)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTGGGCGAAATGCAAATCTATTTTCCAGAGAGCACAGTTKAAGCATTA[T/A]GAGCCTGTTCGCTACCGGGGTAGAATGGCAAACCAAGATCAGGTCAAAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/sl0zzho2