si:ch211-39h10.1

Ensembl ID:
ENSDARG00000078188
ZFIN ID:
ZDB-GENE-070912-291
Description:
FTS and Hook-interacting protein homolog [Source:UniProtKB/Swiss-Prot;Acc:B0V207]
Human Orthologue:
FAM160A2
Human Description:
family with sequence similarity 160, member A2 [Source:HGNC Symbol;Acc:25378]
Mouse Orthologue:
Fam160a2
Mouse Description:
family with sequence similarity 160, member A2 Gene [Source:MGI Symbol;Acc:MGI:1921599]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa789 Nonsense Available for shipment Available now
sa21521 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa789
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110582 Nonsense 223 1124 4 12
Genomic Location (Zv9):
Chromosome 9 (position 33940589)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 33096535
KASP Assay ID:
554-0694.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGATCTTCTCCCTGTTGGTGCCATTTATACATCGAGACGGCGCTCTGGGG[C/T]AGCAGGCACGTGACGCACTGCTCCTYGTCATGGCAACCTCTGCCAGCAAC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa21521
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110582 Nonsense 870 1124 9 12
Genomic Location (Zv9):
Chromosome 9 (position 33933020)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 33088966
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTCGGGAGTCCCGGACTGCGCCTCTGCCCAGCCTGACGGATGAAGACTG[T/A]CTTCCAGTGGAGACTGAGCAGCGCTCCAGTGAAACCAAGCCTGACAGCTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link