tex2

Ensembl ID:
ENSDARG00000078186
ZFIN ID:
ZDB-GENE-070615-7
Description:
testis expressed sequence 2 [Source:RefSeq peptide;Acc:NP_001092722]
Human Orthologue:
TEX2
Human Description:
testis expressed 2 [Source:HGNC Symbol;Acc:30884]
Mouse Orthologue:
Tex2
Mouse Description:
testis expressed gene 2 Gene [Source:MGI Symbol;Acc:MGI:102465]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa20154 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa20154
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108995 Nonsense 1024 1068 11 12
ENSDART00000123544 Nonsense 1026 1070 10 11
ENSDART00000135863 None None 111 None 2
Genomic Location:
Chromosome 3 (position 56355342)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTTTGCCCATGTGACAGACTGGATAGAAAAAAAACTAGATCAGGAATTT[C/T]AGGTAAACATATGTGGATTTTCATGTACATTTGCATGTGATCATTTAGCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/h169dtuj